GENETICS: please explain, I will be tested on this. I want to be sure I understa
ID: 300509 • Letter: G
Question
GENETICS: please explain, I will be tested on this. I want to be sure I understand this question. Thank you for your help.?
7) Your project is to clone the Exam gene into the plasmid pUCSC so that you can express the gene in yeast cells. The sequence of the DNA fragment containing the gene along with Ribosome binding site (RBS) is given. The RBS and the coding region are in bold. The start codon, stop codon and RBS are underlined. There are three different restriction enzyme sites on this DNA fragment. RBS Start Stop 5 AAAGAATTCAAGGCCTGCCACCATGGGGCCCAAAGGGCCCAAATTTTAACCCGTCGACAAA3 3 TTTCTTAAGTTCCGGACGGTGGTACCCCGGGTTTCCCGGGTTTAAAATTGGGCAGCTGTTTSExplanation / Answer
Gene cloning can be done easily by using various restriction enzyme.there are 5 types of restriction enzymes and newly invented artificial restriction enzyme are also available which are used for gene cloning in genetics.zinc finger nuclease are the host specific enzymes which can be used with high site specificity .and its a artificial restriction enzyme this enzyme is capable of recognizing 9-12 base pairs and can also be used in humans..
The other option can be type 5 restriction enzymes they can also cut DNA efficiently if the suitable RNA coding is available and we have that coding with start n stop codon.so type v restriction enzymes can also be used effectively.