Please be very detailed so that I understand. Teacher wants all steps shown and
ID: 301119 • Letter: P
Question
Please be very detailed so that I understand. Teacher wants all steps shown and all logic justified in writing. Even if he does not ask it, he always wants to know WHY which drives me crazy or he gives you no credit.
Also, please note that this is a two part question :)
Thank you so much for the help. I am struggling so much with this subject.
Question 1 Part 1 [7pts] A. The following DNA sequence contains an open reading frame that codes for an 8 amino acid protein. Which open reading frame (1, 2 or 3) would need to be translated to yield that protein? (1pt) TAATGTATATCCCACGGTATGGAGTTTAAG B. In the frame you chose, give an example of a silent mutation at the third amino acid. (2pt) C. Now give an example of a different type of mutation in the same position. What type of mutation is this? (2pt) D. What differentiates the way these two mutations impact the translation process? How does this lead to these two different outcomes? (2pt)Explanation / Answer
Please find the answers below:
Answer 1: According to the information, the sequence of the mRNA to be translated is given as below:
TA ATG TAT ATC CCA CGG TAT GGA CTT TAA G
Part A: It is a very well known fact that initiation of the translation starts from only the start codon, i.e. ATG seqeunce. Since this sequences arrives at the third codon in the contig, translation will start from this third codon only.
Part B: As it can be seen in the contig sequence, the third amino acid would be encoded by the third codon from the start codon which is ATC. This codon encodes for amino acid isoleucine. Thus, a silent mutation in this codon can emerge as either ATT or ATA.
Part C: If the third codon changes from ATC to ATG, it will encode for amino acid methionine. This is a point-substitution type of mutation in which a single nitrogenous base changes the identity of amino acid translated from the codon.
Part D : The nature of codon determines the nature of amino acid being translated in this process. The identity of each codon is determined by a specific amino acyl tRNA synthetase enzyme which is specific for each type of amino acid. Thus, a change in codon sequence changes the nature of amino acyl tRNA synthetase enzyme, hence the nature of amino acid translated from it.