Which of the following statements about this particular sequence of mRNA is true
ID: 303244 • Letter: W
Question
Which of the following statements about this particular sequence of mRNA is true? (use genetic 3' AUGUCGAAUUGUAAAGGUUGAUACCAUGUACCGU 5 code in the lab manual if needed)YY #4 #1 #2 #3 The #1 triplet indicates the start codon, and the #2 triplet indicates the stop codon. The #1 triplet indicates the start codon, and the #3 triplet indicates the stop codon. The #4 triplet indicates the start codon, and the #3 triplet indicates the stop codon. The #4 triplet indicates the start codon, and the #2 triplet indicates the stop codon.Explanation / Answer
In the Genetic code system, AUG codes for start codon (as well as methuonine).
The stop codons are UGA, UAG and UAA (also called as opal, amber and ochre).
So in the given sequence, #1 triplet indicates the start codon and #3 triplet indicates stop codon. Second option is correct.