Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Certain genes of human papilloma virus are encoded by partially overlapping read

ID: 314985 • Letter: C

Question

  Certain genes of human papilloma virus are encoded by partially overlapping reading frames. The following sequence encodes both the 3’ end of the E1 coding region and a portion of the 5’ end of the E2 gene. (Both genes are encoded on the same strand).

The symbol § indicates the first base of a codon in the E1 reading frame, while ¶ indicates the start of a codon in the E2 reading frame. Translate the sequence in both reading frames. Use a genetic code chart from your book or other reliable source.

                 TCAGCTAATGAACATTTATGA

                  §¶

Explanation / Answer

Answer:

First reading frame, E1:

DNA sequence: TCAGCTAATGAAVATTTATGA (The start codon has been underlined)

Translated sequence: S A N E H L Stop

Second reading frame, E1: TCAGCTAATGAACATTTATGA (The start codon has been underlined)

Translated sequence: Q L Met N I Y

The encoded protein in the E2 reading frame starts with Met.