There are many approaches to determine the function of a DNA sequence that has n
ID: 3164521 • Letter: T
Question
There are many approaches to determine the function of a DNA sequence that has not been characterized. One method is to intentionally mutate the DNA sequence and study the phenotype of a cell or organism with the mutated sequence compared to a cell or organism with the non-mutated sequence. This comparison can allow you to infer something about the function of the DNA sequence. Hypothetical: Imagine you are studying a new bacterial species. Your colleagues have sequenced the entire genome of the species and determined what parts of the genome are protein-coding genes. It is now your job to determine the function of these protein-coding genes. You decide to use a mutagen to cause a mutation in each gene and study the phenotype in the mutant bacterial cell. Gene 1: The following is the DNA sequence for the first protein-coding gene. 5'ATTATGGAGTAT??CAAC?CACTTAGAA 3' 3' TAATACCTCATAGAGTTGGGTGAATCTT S' A. Determine the RNA sequence that would be transcribed from this DNA sequence. The top strand is the coding, or non-template, strand. Indicate 5' and 3' ends. UCU Phe BE Second mRNA base A . UAU2 UGU U UCC UAC 'UGC c UAA Stop UGA Stop A UAG Stop CGU ISB CAU ? Pro 888 B.Using the genetic code, determine the protein sequence that would be translated from the RNA. Note, be sure you use the correct reading frame (how is this set?). First mRNA base (5' end of codon) 0 C 0 > 0 Third mRNA base (3° end of codon) C 0 > ACU ACC llo | AA AAG c GUU GUC GUA GUG GCU GCC GCA GCG C. Using a mutagen, you are able to change the second G in the DNA sequence of the coding or non-template strand to a T (count from the 5' end of the coding strand). How would that impact the protein translated? What type of mutation is this? GAA GAGGGG > O D. You observe that in a non-mutant bacterial cell, the lac gene (which is important for transporting lactose into the cell and using it for energy) is transcribed and translated; however, in your mutated cell that doesn't produce function protein 1, the lac gene is not transcribed or translated. You infer that gene 1 must encode a protein important for ensuring the lac gene is transcribed/translated. Based on this information and what we have learned in class, what is one possible function of Gene 1 in this bacterial species? (i.e. What type of protein does Gene 1 must likely code for?) Explain.Explanation / Answer
Answer:
A). mRNA---5’-AUU AUG GAG UAU CUC AAC CCA CUU AGA A-3’
B). Amino acids- Ile-Met-Glu-Tyr-Leu-Asn-Pro-Leu-Arg
C). By the change from GAG to TAG, mRNA becomes GAG (Glu) to UGA (Stop). Becuause of the change in nucleotide, it is lead to the termination of peptide synthesis. Hence, it is called nonsense mutation.