8. During cycle three, new DNA strands will be synthesized from T1, T2, C1F, CIR
ID: 3164859 • Letter: 8
Question
8. During cycle three, new DNA strands will be synthesized from T1, T2, C1F, CIR, C2F, and C2R Show the sequences fo the new strands from C2F and C2R below: label 5' and 3' of newly synthesized strands) C2R 3 CATATGGACGCTTCGTTTTCT5 C3 5' GTATA C3 ????? C2F 5 GTATA CCTGCGAAGCAAA AGA 3 You should be able to see that you now have one copy of your target sequence (step 6). What is the size fragment that you have amplified? That is, how many base-pairs is your target sequence? 9. 10. How did you ensure that you were amplifying that particular segment (sequence) of DNA?Explanation / Answer
Sequence of C2R from the 3'- 5'
5; GTATACCCTGCGAAGCAAAAGA3'
Sequence of of C2F from 5'-3'
3' CATATGGACGCTTCGTTTTCT 5'
Then size of fragment which is amplified 22bp each
Gel eletroforesis is used to ensure the amplification of particular DNA after PCR. If band are present after staining it means DNA are amplified and if band absent then no amplification occur.