Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

25. Which letter represents the most recent common ancestor of the monophyletic

ID: 3164893 • Letter: 2

Question

25. Which letter represents the most recent common ancestor of the monophyletic group thot contains terminol tox?'8ord r, b) Y d) Y or z e) None of the obove. 26. What type of phylogenetic grouping would "sCD constitute a) Monophyletic b) Polyphyletic c) Paraphyletic d) Two of the above may be applicoble e) None of the above Questions 27-29 are based on the phylogeny and associated data matrix below: Anacardium eccidentale ACCGTGAACTGGCATACAANGA Maogifena indics ACCSTGAACTGGCATACANAGA Antrocarcyon amazanicum ACCGTGAACTGCCATACATAGA Eegia nitide ACCGTGAACTGCCATACATAGA Rhus eromatice ACCSTGAACTSGCATACATAGA Pegie nitids 27. What is the synapomorphy that defines node "X? a) A transition from DNA nucleotide C to nucleotide G at sequence position 2 b) A transition from DNA nucleotide A to nucleotide T at sequence position 3 c) A transition from DNA nucleotide G to nucleotide C at sequence position 1 d) Both (a) and (b). e) None of the above 5

Explanation / Answer

25. (a) X

X is the most recent common ancestor of B and E. They diverge immediately after that, at the resulting node.

26. (b) Polyphyletic

B, C, D do not share an immediate common ancestor. So this would make the classification Polyphyletic.

27. (c) A transition from G to C

Mutations occur very rarely in the genome. It makes sense that ancestor X would have a 'G' nucleotide which randomly mutated (stably ) into a 'C' nucleotide ( which can be seen in all descendants of Y ). Somewhre in the course of evolution, a descendant of Y underwent more 2 transitions that led to further branching, as is evident.