melting tempera three DNA sequences (only forward strand shown) in order 1)GCATT
ID: 3166662 • Letter: M
Question
melting tempera three DNA sequences (only forward strand shown) in order 1)GCATTGACCTCTGA 2)GGGATTCGTATCCTGACATC 3)ATTCTTGAAACAAT e. 1,3,2 d. 2,3,1 b. 3,2,1 c. 2,1,3 16. Put the following CRISPR steps in order A guide RNA and endonuclease complex bind DNA sequence B nonhomologous end joining causes insertions and deletions C complementary guide RNA for region of interest is generated D. double-stranded breaks are produced e. C, A, D, B a.A,B,CD 17. PCR is used to amplify DNA. Suppose a single linear molecule of dsDNA is amplified by PCR. How many would be present after one PCR cycle? After 3 PCR cycles? After 30 PCR cycles? a. 2, 8, -34 million b. 2, 16, -1 billion c. 2, 8, -1 billion d. 3,27,-1 billion e. 3, 52, -34 million 18. messenger RNA (mRNA)? convplementary DNA LDNA s a double-stranded molecule n the laboraton, how s ONA generatedfrom a eukaryotic a. Reverse transcriptase generates a single-stranded cDNA and then DNA polymerase synthesizes the complementary strand. double-stranded DNA. complementary RNA strand. e. None of the above. b. Reverse transcriptase generates two single-stranded cDNAs from c. Reverse transeriptase generates single-stranded coNA then uses that cONA as a template to synethesize a d. Reverse transcriptase generates a single-stranded cONA and then DNA ligase synthesizes the complementary strand different mRNA molecules which hybridize to form 19. Name the glycerophospholipid shown below: a. phosphatidic acid b. phosphatidylinositol c. phosphatidylethanolamine d. e. phosphatidylserine 20. Arrange the following fatty acids from highest melting point to lowest melting point. B. CH (CHz COOH C. CHICH?COOH a. C, B, D, A b. A, B, D, C C, A, B, C, D d. D. C, B, A 21. Cholesterol is at that contains and a. isoprenoid lipid, three fused rings; modulates membrane fluidity b. sterol lipid; four fused rings; modulates membrane fluidity c. steroid hormone; four fused rings; transmits signals to remote parts of the body d. isoprenoid lipid; four fused rings; modulates membrane fluidity e. sterol lipid; three fused rings; modulates membrane fluidityExplanation / Answer
Answer 15: c) 2,1,3
GC content is highest in sequence 2 and lowest in sequence 3
Answer 16. e) C,A, D, B
Answer 17. c) 2, 8, 1 billion (21, 23, 230)
Answer 18: a) Reverse transcriptase generates single stranded cDNA and then DNA polymerase synthesizes a complementary strand to it
Answer 19: d) phosphatidylcholine
Answer 20: a) C, B, D, A
Answer 21 b) sterol lipid; four fused rings; modulates membrane fluidity