Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUU
ID: 3167089 • Letter: A
Question
Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each and Gly to use two tRNAs, therefore the minimum number of tRNAs required to translate the mRNA sequence is ten. The mRNA sequence is forty-five nucleotides long; therefore fifteen different tRNAs are needed to translate the sequence. If wobble rules are not used, then the minimum number of tRNAs needed to translate the mRNA sequence is thirteen. The translated peptide has nine different amino acids. Therefore, a minimum of nine different tRNAs are needed to translate the mRNA sequence. ? The last codon (3' end) terminates translation.Explanation / Answer
ANSWER:
Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each and Gly to use two tRNAs, therefore the minimum number of tRNAs required to translate the mRNA sequence is ten
Explanation:
The Wobble Hypothesis explains why multiple codons can code for a single amino acid. One tRNA molecule (with one amino acid attached) can recognise and bind to more than one codon, due to the less-precise base pairs that can arise between the 3rd base of the codon and the base at the 1st position on the anticodon.