Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

You have to amplify fixed size 3.5 kb product from isolated genomic DNA using fo

ID: 319995 • Letter: Y

Question

You have to amplify fixed size 3.5 kb product from isolated genomic DNA using forward and reverse primers below:

Primer-F:    CGTTTCCCGCCTTCAGTTTAGC

Primer-R: CCCGATCTAGTAACATAGATGACACC

a.) calculate melting and annealing temperatures for each primer (using GC+AT formula), show your calculations. Indicate temperature you will use for PCR amplification of this fragment and explain your choice.

b.) Based on protocol we used in class for DreamTaq DNA polymerase design PCR cycling program for amplification of this fragment.

Explanation / Answer

The formula used for Tm calculation is:

Tm = 2 x (A+T) + 4 x (G+C)

Tm of Primer F: 2 x (2+8) + 4 x (4+8)

= 2 x 10 + 4 x 12

= 20 + 48

= 68 C

Tm of Primer R: 2 x (9+5) + 4 x (4+8)

= 2 x (14) + 4 x (12)

= 28+ 48

= 76 C

Based on Tm values, wr can deside annealing temperature. By average both Tm values and take + / - of 5 C as Annealing temperature for this PCR reaction

68 + 76 / 2

= 72 C

So take 67 C as Annealing temperature