You have to amplify fixed size 3.5 kb product from isolated genomic DNA using fo
ID: 319995 • Letter: Y
Question
You have to amplify fixed size 3.5 kb product from isolated genomic DNA using forward and reverse primers below:
Primer-F: CGTTTCCCGCCTTCAGTTTAGC
Primer-R: CCCGATCTAGTAACATAGATGACACC
a.) calculate melting and annealing temperatures for each primer (using GC+AT formula), show your calculations. Indicate temperature you will use for PCR amplification of this fragment and explain your choice.
b.) Based on protocol we used in class for DreamTaq DNA polymerase design PCR cycling program for amplification of this fragment.
Explanation / Answer
The formula used for Tm calculation is:
Tm = 2 x (A+T) + 4 x (G+C)
Tm of Primer F: 2 x (2+8) + 4 x (4+8)
= 2 x 10 + 4 x 12
= 20 + 48
= 68 C
Tm of Primer R: 2 x (9+5) + 4 x (4+8)
= 2 x (14) + 4 x (12)
= 28+ 48
= 76 C
Based on Tm values, wr can deside annealing temperature. By average both Tm values and take + / - of 5 C as Annealing temperature for this PCR reaction
68 + 76 / 2
= 72 C
So take 67 C as Annealing temperature