Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Transcription is the process of \"reading\" DNA and generating an RNA molecule.

ID: 323257 • Letter: T

Question

Transcription is the process of "reading" DNA and generating an RNA molecule. When RNA is generated by an RNA polymerase, it "reads" the sequence of a template DNA in a 3' to 5' direction and synthesizes a complementary molecule of RNA in a 5' to 3' direction. Assuming the following is just part of a template DNA sequence that is being transcribed by an RNA polymerase, what is the correct RNA sequence (be sure to indicate direction of the strands)? 3..GTCGGTCGAATGCGG....5' What if the template 5'... GTGGTC AACGTTCG ATGCT A AC... 3 ' What would the RNA sequence be if this was the NON-template (or coding) strand of 5'..GGTCCTCAATGTCGA...3'

Explanation / Answer

The solution can be arrived at by applying the rules of base pairing,

Adenine (A) pairs with Thymine (T) in DNA and Uracil (U) in RNA
Guanine (G) pairs with Cytosine (C)

Part 1:
Given template strand -      3' - GTCGGTCGAATGCGG - 5'
RNA strand -                    3' - GUCGGUCGAAUGCGG - 5'

Part 2:
Given template strand -       5'- GTGGTCAACGTTCGATGCTAAC - 3'
RNA Strand -                 5'- GUGGUCAACGUUCGAUGCUAAC - 3'

Part 3:
Given non template strand -           5'- GGTCCTCAATGTCGA- 3'
Complementary Template strand - 3'- CCAGGAGTTACAGCT - 5'
RNA Strand -    5'- GGUCCUCAAUGUCGA- 3'