Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

14. (2 pts) All genes in an organism\'s genome are vulnerable to mutation. Expla

ID: 33197 • Letter: 1

Question

14. (2 pts) All genes in an organism's genome are vulnerable to mutation. Explain the following: High-fidelity DNA replication is beneficial because: Low-fidelity DNA replication is beneficial because: 15. (3 pts) Examine the DNA sequence below. 3' ATCGTACGAAAATCCCAGCATGGCCATA 5 What would be the effect on the protein product of this gene if A. Two nucleotides, T and G, were inserted in the center of the "AAAA" sequence? B. All three cytosine's are lost in section C. One nucleotide was inserted and another was deleted.

Explanation / Answer

14). High fidelity DNA synthesis is beneficial because it can inhibit the initiation and promotion of diseases caused by gene mutation such as cancer, other muscle and neurodegenerative disorders. Thus, it maintains genetic information of generations together and avoids mutation.

Low fidelity DNA synthesis plays an important role in evolution and genetic diversity. It is beneficial for the normal development of immune system and increased survival of viruses and microbes when subjected to changing atmospheres.

15). A permanent change in the sequence of nucleotides of the genome is called mutation, which results in altered or absence of corresponding protein synthesis. Mutation may occur either in DNA or RNA, and can be inherited. Based on the way of change in base sequence in the genome, they are classified into point mutations and chromosomal mutations.

A). Insertion or deletion of single base pairs in DNA results in frame shift mutations, in this; the reading frame shifts at the point of mutation and results in non-functional proteins. If nucleotides T and G are inserted, it results in an frame shift mutaion.

B). Insertion or deletion of single base pairs in DNA results in frame shift mutations, in this; the reading frame shifts at the point of mutation and results in non-functional proteins. If nucleotides CCC are lost (deletion), it results in an frame shift mutaion.

C). Simultaneous insertion and deletion of two nucleotides also results in frameshift mutaion.