Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Transcription and post-transcriptional processing 2. Draw the capped transcript

ID: 34210 • Letter: T

Question

Transcription and post-transcriptional processing 2. Draw the capped transcript 5' UCG 3'. (draw 5' UCG 3', now add the 5' cap) 3. Using a line drawing, draw a primary transcript that contains 3 introns. Label all of the parts. 4. Using a line drawing, draw a messenger RNA. Label all of the parts. 5. Explain how the poly-A tail is added to eukaryotic transcripts. Protein structure 5. Draw the chemical structure of the polypeptide NH2-MET-LEU-ARG-PHE-COOH 6. Translate the following open reading frame: 5' AUGGCAUUACUGGUGAUACCUGCGACGUUUAUUUAUCUUUAG 3' Write the sequence of the polypeptide using the 3 letter code. DO NOT DRAW THE CHEMICAL STRUCTURE

Explanation / Answer

Transcription and post transcriptional processing:

2. m7Gppp-5'-UCG-3'

where ppp represents the triphosphate bond. m7 means methylation at 7-position.

5. The Poly A tail in mRNA defines the termination of transcription in eukaryotes. Two proteins namely CstF (cleavage stimulation factor) and CPSF (cleavage and polyadenylation specificity factor) travel to the tail (CTD) of RNA polymerase and travel with the RNA polymerase tail and are transferred to the 3