Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Problem 1. This RNA sequence contains one complete open reading frame (ORF). A c

ID: 34649 • Letter: P

Question

Problem 1. This RNA sequence contains one complete open reading frame (ORF). A complete open reading frame contains an AUG start codon and an in-frame stop codon. 5' GGCUUAUGUAGUAAUGAUAUGCCUUAUUUUAGCCUGAUAGUC 3' 1A. TRANSLATE this sequence. Write the primary sequence using the three letter code. Example: +3HN-ala-his-lys-arg-Coo- 1B. Draw the chemical structure of this polypeptide. 1C. What is the approximate molecular weight of this polypeptide? The average molecular weight of an amino acid in a polypeptide (including the side chain) is 115 Daltons.

Explanation / Answer

Problem 1:

5