Problem 1. This RNA sequence contains one complete open reading frame (ORF). A c
ID: 34649 • Letter: P
Question
Problem 1. This RNA sequence contains one complete open reading frame (ORF). A complete open reading frame contains an AUG start codon and an in-frame stop codon. 5' GGCUUAUGUAGUAAUGAUAUGCCUUAUUUUAGCCUGAUAGUC 3' 1A. TRANSLATE this sequence. Write the primary sequence using the three letter code. Example: +3HN-ala-his-lys-arg-Coo- 1B. Draw the chemical structure of this polypeptide. 1C. What is the approximate molecular weight of this polypeptide? The average molecular weight of an amino acid in a polypeptide (including the side chain) is 115 Daltons.Explanation / Answer
Problem 1:
5