Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Here\'s a genome: 5\'-GAT GTA TAATCGAGACATC C CTTAGAAATGCTTCTGCCATGGTTATTCCCACAA

ID: 3466 • Letter: H

Question

Here's a genome:

5'-GATGTATAATCGAGACATCCCTTAGAAATGCTTCTGCCATGGTTATTCCCACAAA-3'

The transcription start site has been bold-italicized.

a. What is the transcriptional regulatory element presentupstream of the transcription start site, and describe itsfunction.

My answer: The TATA box which is located in the promoterregion. It helps in the binding of transcription factors (I'mguess, I do not know).

b. Underline the translation initiation codon.

It's AUG right? I underlined GTA which is read backwards asAUG.



Explanation / Answer

      First of all let me saythat the mechanism of transcription is the synthesis of RNA.       For this to occur the DNAstrand which is 3'-5' direction acts as the template and not the5'- 3' strand.       The DNA strand given by you isin 5'-3' direction, so; RNA cannot be synthesized from thisstrand.       The complementary strandof this can act as a template for transcription.       So, the complementarystrand for this will be as:( the highlighted one)        5'-GATGTATAATCGAGACATCCCTTAGAAATGCTTCTGCCATGGTT ATTCCCACAAA-3'
       3'- CTACATATTAGCTCTGTAGGGAATCTTTACGAAGACGGTACCAATAAGGGTG TTT-5'              The RNA strand for this isrepresented as:(the red strand)        3'- CTACAT ATTAG CTCTGT AGGGAATCTTT ACGAAGACGGT ACCAATAAGGGTG TTT-5'       5'- GAUGUAUAAUCGAGACAUCCCUUAGAAAUGCUUCUGCCAUGGUUAUUCCCACAAA-3'              The transcriptionalregulatory element present upstream of transcription start site isthe promoter region. This is the right       answer ofyours.       But, if this genome is ofprokaryotes, the promoter region will be as TATAAT and if itis eukaryotic then it is as       TATAAA(TATA box)       Yeah, promoter regionhelps RNA polymerase to bind in prokaryotes and in eukaryotestranscription factors will bind        to it.       The function of promoterregion is to help RNA polymerase recognise the transcription siteand the DNA also starts to        unwind in thisregion to initiate transcription                     The transcriptionalregulatory element present upstream of transcription start site isthe promoter region. This is the right       answer ofyours.       But, if this genome is ofprokaryotes, the promoter region will be as TATAAT and if itis eukaryotic then it is as       TATAAA(TATA box)       Yeah, promoter regionhelps RNA polymerase to bind in prokaryotes and in eukaryotestranscription factors will bind        to it.       The function of promoterregion is to help RNA polymerase recognise the transcription siteand the DNA also starts to        unwind in thisregion to initiate transcription                      Yeah your answer for thecodon for initiation of translation AUG is right.       But your sense in this iswrong. I mean, you said GTA is read in backwards as AUG: this isnot true and in any way       GTA cannot code forAUG             I didnot find any TATA boxin the DNA strand or the AUG codon in the RNA strand.     I hope this answer helpedyou.