Who can answer this questions correctly? A eukaryotic mRNA has the following seq
ID: 35577 • Letter: W
Question
Who can answer this questions correctly?
A eukaryotic mRNA has the following sequence. The 5' cap is indicated in italics (CAP), and the 3' poly(A) tail is indicated by italicized adenines.
5'-CAP CCAAGCGUUACAUGUAUGGAGAGAAUGAAACUGAGGCUUGCCACGUUUGUUAAGCACCUAUGCUACCG AAAAAAAAAAAAAAAAAAAAAAAA-3'
Part A
Determine the amino acid sequence of the polypeptide produced from this mRNA.
(Hint: Remember that there is a specific codon that initiates translation.)
Express your answer as a sequence of three-letter amino acid abbreviations separated by dashes. Example: Val-Ile-His-...-Glu.
N- -C
Problem 10.24
Part B
In northern blot analysis of mRNA, what mRNA differences would you anticipate for your two proposed mutational mechanisms?
Check all that apply.
The deletion would not alter the size of the stature mRNA. The deletion would alter the size of the stature mRNA. The point mutation would alter the size of the stature mRNA. The point mutation would not alter the size of the stature mRNA. Who can answer this questions correctly? A eukaryotic mRNA has the following sequence. The 5' cap is indicated in italics (CAP), and the 3' poly(A) tail is indicated by italicized adenines. 5'-CAP CCAAGCGUUACAUGUAUGGAGAGAAUGAAACUGAGGCUUGCCACGUUUGUUAAGCACCUAUGCUACCG AAAAAAAAAAAAAAAAAAAAAAAA-3' Part A Determine the amino acid sequence of the polypeptide produced from this mRNA. (Hint: Remember that there is a specific codon that initiates translation.) Express your answer as a sequence of three-letter amino acid abbreviations separated by dashes. Example: Val-Ile-His-...-Glu. N- -C Problem 10.24 Part B In northern blot analysis of mRNA, what mRNA differences would you anticipate for your two proposed mutational mechanisms? Check all that apply. The deletion would not alter the size of the stature mRNA. The deletion would alter the size of the stature mRNA. The point mutation would alter the size of the stature mRNA. The point mutation would not alter the size of the stature mRNA.Explanation / Answer
The point mutation would not alter the size of the stature mRNA.