n molecular biology the \"alphabet\" of genes consists of four chemicals (called
ID: 3659815 • Letter: N
Question
n molecular biology the "alphabet" of genes consists of four chemicals (called nucleotides) represented by the letters A C G T. A triad is a sequence of three nucleotides (for example AGA) and specifies an amino acid, a building block for proteins. A gene consists of a very, very long sequence of A-C-G-T combinations. Assume the input consists of a long sequence of A-C-G-T letters representing a gene. Write the code necessary to skip over the first 7 letters and then read the next 4 triads, printing each out on its own line.Explanation / Answer
C - CODE
#include<stdio.h>
void triad(char* genome){
char *p; p = genome + 7;
int i = 0;
for (i=0;i<4;i++){
printf("%c%c%c ",p[0],p[1],p[2]);
p+=3;
}
}
int main(){
char str[80] = "agcttacagctattagctagcttagagacc";
triad(str);
return 0;
}