Using Matlab I need a way to decrypt/convert this DNA strand to be equal to pi.
ID: 3676878 • Letter: U
Question
Using Matlab I need a way to decrypt/convert this DNA strand to be equal to pi. Hint: the decimal point maps to ’t’ but only once , you’ll need to figure out what 0-9 maps to. I figured that 1-3 is g, 4-6 is c, 7-9 is a and t is 0 and a decimal point. Not getting how to let one letter represent more than one number, and pi doesn't really have a pattern.
dna ( 1000 values) =
gtgcgcagccgcaaaagggaccgccggaggaactgaacgaagcagaagacgtcagtaacacccaggtaagcctcgacgtaaaacgatgcagcgcgggatcaaaggcataccgggaggtcccatagaccctacctcaggggagcgcactaggacagggacctgacgtgatgagacgggtcccaccccggacaaccagtgagacccgaagtaaccccaggcccggacacccagggaacaaggccgaggtgatagccccacccaggcctgcacgtcccggcccaggggagctagctgcagcggagagccaattcctcggccaagacaagcgtagtacgagagcctagagcgccgcaaagcatgcttggggtcgtccaagtccccgggacgccacgacgcggctacggtcagatgccacacagacgtaggacggagagaggcggaaggtcggaccatacccggaaacgacaccagcgaacacgagcaagggaagagagtggacaggaaggcaggcgcctcccccgtactgggacaccgacggcagagatatggaaactacgatgaatcgaggagacgaggacacggaccacagaccaccactcgggtttccaggagccgcgcctagaaacaaggcgacaaaactagagcgagaaaggccacctatgggcacgcgtgccccacacgagtctaaggaacaagcaaggccgtgaaccgggggatggactacctgccgagcaaggcgaaacaaggtaactcgaataggggcaaaaaaagagaaatcaacgtcaaggaggagctacggacactgcccacccgccatagtgccgcgggtagcggcccactgcgcgagggaagagtgtttgggaagaacgaaccaacgggtagagcgtcgagaaccagcagtgcaagcgcatcgaaccccaagggcaccgacgaaggcgaaacagacgacaaagacaaatcgggagggcatccggttgagaaaccgggacataggccgtgaa
thank you!
Explanation / Answer
About DNA sequence: A DNA sequence consists of four nucleic acid bases A (adenine), C (cytosine), G (guanine), T (thymine), where A and T are complementary, and G and C are complementary. So these can be used to denote specific values, like C=0, T=1, A=2 and G=3.
Regarding given DNA sequence: Read string from left to right character by character and try to decode as per following patterns:
1. First character of the string i.e. 'g' will be decoded as 3.
2. First 't' will be decoded as decimal '.'.
3. Now after decimal, decode as per the following patterns:
a) first 'g' after decimal will be decoded as 1.
b) For next characters -
i) whenever a 'c' is found, decode it as per the sequence - 4 -> 5 -> 6. Meaning first 'c' will be decoded as 4, next 'c' as 5, and then as 6. Once three occurrences of 'c's are decoded, then decoding of 'c' will again start from 4.
ii) whenever a 'g' is found, decode it as per the sequence - 1 -> 2 -> 3. Meaning first 'g' will be decoded as 1, next 'g' as 2, and then as 3. Once three occurrences of 'g's are decoded, then decoding of 'g' will again start from 1.
iii) whenever a 'a' is found, decode it as per the sequence - 9 -> 8 -> 7. Meaning first 'a' will be decoded as 9, next 'a' as 8, and then as 7. Once three occurrences of 'a's are decoded, then decoding of 'a' will again start from 9.
Continue like this till string is over.
Hope this helps you.