I have already written a program for the query below. I need your help to c hang
ID: 3680184 • Letter: I
Question
I have already written a program for the query below. I need your help to change characters to strings (use strings instead of letters). Hint: change the Codon class to use private String triplet instead of private char [ ] triple and change other methods correspondingly. Here is a link to the class files and input for the program:
https://www.dropbox.com/sh/tbj2n8nsilabojx/AAB7-6gUbxjOF0Ukb4F9oGj9a?dl=0
The genes in DNA molecules in a cell carry instructions of how to make proteins. To make a protein, a DNA segment containing the instructions is transcribed to a messenger RNA (mRNA) molecule through a process called transcription. The resulting mRNA is then translated into a sequence of amino acids called polynucleotide and folded into correct 3D shape to form a protein molecule. This process is called translation. The rules of translation is called genetic code. Translation starts at the first start codon (“AUG”, it also codes for Met amino acid), it will then continue to translate each codon (triple letters ) to an amino acid according to the genetic code until it reaches any of the three stop codons (“UAA”, “ UAG”,”UGA”, they do not code amino acids but terminate translation process).
Functional Parts of the Program
1. Let a user to select an input file:
FileChooser fileChooser = new FileChooser();
fileChooser.setInitialDirectory(new File("."));
File file = fileChooser.showOpenDialog(primaryStage);
2. Read the input file with specific format to a String, mRNA.
The mRNA is denoted as a sequence of letters of UCAG spread in multiple lines. Each line starts with an integer that is the starting position (notice it starts with 1, not 0) of the first letter in the line. All lines but the last line have 60 letters. The last line may has less than 60 letter.
Sample input file: (insulin related mRNA for human)
1 AUUACCAUAUCAGAUUCACAUUCAGUCCUCAGCAAAAUGAAGGGCUCCAUUUUCACUCUG
61 UUUUUAUUCUCUGUCCUAUUUGCCAUCUCAGAAGUGCGGAGCAAGGAGUCUGUGAGACUC
121 UGUGGGCUAGAAUACAUACGGACAGUCAUCUAUAUCUGUGCUAGCUCCAGGUGGAGAAGG
181 CAUCAGGAGGGGAUCCCUCAAGCUCAGCAAGCUGAGACAGGAAACUCCUUCCAGCUCCCA
241 CAUAAACGUGAGUUUUCUGAGGAAAAUCCAGCGCAAAACCUUCCGAAGGUGGAUGCCUCA
301 GGGGAAGACCGUCUUUGGGGUGGACAGAUGCCCACUGAAGAGCUUUGGAAGUCAAAGAAG
361 CAUUCAGUGAUGUCAAGACAAGAUUUACAAACUUUGUGUUGCACUGAUGGCUGUUCCAUG
421 ACUGAUUUGAGUGCUCUUUGCUAAGACAAGAGCAAAUACCCAAUGGGUGGCAGAGCUUUA
481 UCACAUGUUUAAUUACAGUGUUUUACUGCCUGGUAGAACACUAAUAUUGUGUUAUUAAAA
541 UGAUGGCUUUUGGGUAGGCAAAACUUCUUUUCUAAAAGGUAUAGCUGAGCGGUUGAAACC
The program should read the input file and store all letters in one string, no numbers, no spaces, and no line breakings. I highlighted the start codon, coding region and stop codon
3. Translate the mRNA to a sequence of amino acids: First scan the mRNA (a sequence of letters containing U,C,A,G only) to search the first start codon “AUG”, that is the first codon. It shall be translated to “Met” by the Figure. This first AUG will set up framing: read each triple letters, a codon, and translate it to an amino acid if it is not a stop codon according to the table in Firure1. After the first codon AUG is read, if any of the 3 stop codon is read, translation process is terminated. Notice stop codons do not code for any amino acid.
Untranslated Region:
AUUACCAUAUCAGAUUCACAUUCAGUCCUCAGCAAA
Starting position: 37
Met Lys Gly Ser Ile Phe Thr Leu Phe
Leu Phe Ser Val Leu Phe Ala Ile Ser Glu Val Arg Ser Lys Glu Ser Val Arg Leu Cys
Gly Leu Glu Tyr Ile Arg Thr Val Ile Tyr Ile Cys Ala Ser Ser Arg Trp Arg Arg His
Gln Glu Gly Ile Pro Gln Ala Gln Gln Ala Glu Thr Gly Asn Ser Phe Gln Leu Pro His
Lys Arg Glu Phe Ser Glu Glu Asn Pro Ala Gln Asn Leu Pro Lys Val ASp Ala Ser Gly
Glu Asp Arg Leu Trp Gly Gly Gln Met Pro Thr Glu Glu Leu Trp Lys Ser Lys Lys His
Ser Val Met Ser Arg Gln ASp Leu Gln Thr Leu Cys Cys Thr ASp Gly Cys Ser Met Thr
ASp Leu Ser Ala Leu Cys
Stoping position: 442
Untranslated Region: UAAGACAAGAGCAAAUACCCAAUGGGUGGCAGAGCUUUA
UCACAUGUUUAAUUACAGUGUUUUACUGCCUGGUAGAACACUAAUAUUGUGUUAUUAAAA
UGAUGGCUUUUGGGUAGGCAAAACUUCUUUUCUAAAAGGUAUAGCUGAGCGGUUGAAACC
4. GUI design and output. Be creative.
5. Draw UML for an object oriented design
6. Line up each codon in one line with corresponding amino acid at next line.
And display codon and its amino acid with same color.
7. Change characters to strings (use strings instead of letters)
(i) You change the Codon class to use private String triplet instead of private char [ ] triple and change other methods correspondingly
(ii) Change the GUI, use different layout, print on canvas for example.
Thank you!
Explanation / Answer
Please use the below codon.java file in order to use string instead of char:
import com.google.common.base.Objects;
import com.google.common.collect.Table;
import com.google.common.collect.TreeBasedTable;
import com.google.gson.*;
import org.apache.log4j.Logger;
import org.broad.igv.util.ParsingUtils;
import java.io.BufferedReader;
import java.io.IOException;
import java.io.InputStream;
import java.io.InputStreamReader;
import java.util.*;
public class AminoAcidManager {
private static final Logger log = Logger.getLogger(AminoAcidManager.class);
/**
* File which contains listing of amino acid names.
* Format: Full Name 3 letter abbreviation Single letter abbrev.
*/
private static final String AANameFilePath = "resources/AANamesTable.txt";
/**
* Table containing mapping from string forms (full, TLA, single-letter-abbrev)
* to amino acid object. No codon information stored here
*/
private static final Map<String, AminoAcid> AANameMap = new HashMap<String, AminoAcid>(20);
private static final String[] BASE_SEQUENCES = {"TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG",
"TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG",
"TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG"};
static final String DEFAULT_CODON_TABLE_PATH = "resources/geneticCode.json";
static final String DEFAULT_TRANS_TABLE_PATH = "resources/defaultTranslationTables.json";
//ID of the "standard" translation table
public static final int STANDARD_TABLE_ID = 1;
private static final String DEFAULT_CHROMO_KEY = "default";
private LinkedHashMap<CodonTableKey, CodonTable> allCodonTables = new LinkedHashMap<CodonTableKey, CodonTable>(20);
private CodonTable currentCodonTable;
private static Table<String, String, CodonTableKey> genomeChromoTable = TreeBasedTable.create();
private static AminoAcidManager instance;
private AminoAcidManager() {
initAANameMap();
try {
loadDefaultTranslationTables();
} catch (JsonParseException e) {
log.error(e);
}
}
public static AminoAcidManager getInstance() {
if (instance == null) {
try {
AminoAcidManager newInstance = new AminoAcidManager();
newInstance.loadCodonTables(DEFAULT_CODON_TABLE_PATH);
instance = newInstance;
} catch (IOException e) {
handleExceptionLoading(e);
} catch (JsonParseException e) {
handleExceptionLoading(e);
}
}
return instance;
}
public static AminoAcidManager resetToDefaultCodonTables() {
instance = null;
return getInstance();
}
private static void handleExceptionLoading(Exception e) {
log.error(e);
if (instance == null) {
throw new IllegalStateException("No codon table present, and error loading " + DEFAULT_CODON_TABLE_PATH, e);
}
}
/**
* Removes all codon tables.
* Mainly for testing
*/
synchronized void clear() {
allCodonTables.clear();
currentCodonTable = null;
}
/**
* Each codon translation table is identified by an integer id
* These are specified in the file. We specify a table
* by filename/id combination
*
* @param codonTablePath
* @param id
* @return Whether setting the table was successful
*/
public boolean setCodonTable(String codonTablePath, int id) {
CodonTableKey key = new CodonTableKey(codonTablePath, id);
return setCodonTable(key);
}
public boolean setCodonTable(CodonTableKey key) {
if (allCodonTables.containsKey(key)) {
currentCodonTable = allCodonTables.get(key);
return true;
} else {
return false;
}
}
/**
* @param codon 3-letter nucleotide sequence
* @return The amino acid represented by this codon, as
* decoded from the current codon table
*/
public AminoAcid getAminoAcid(String codon) {
return currentCodonTable.getAminoAcid(codon);
}
/**
* Return a list of amino acids for the input sequence of nucleotides
*
* @param direction
* @param sequence
* @return
*/
List<AminoAcid> getAminoAcids(Strand direction, String sequence) {
// Sequence must be divisible by 3. It is the responsibility of the
// calling program to send a sequence properly aligned.
int readLength = sequence.length() / 3;
List<AminoAcid> acids = new ArrayList<AminoAcid>(readLength);
for (int i = 0; i <= sequence.length() - 3; i += 3) {
String codon = sequence.substring(i, i + 3).toUpperCase();
if (direction == Strand.NEGATIVE) {
codon = getNucleotideComplement(codon);
}
AminoAcid aa = currentCodonTable.getAminoAcid(codon);
acids.add(aa);
}
return acids;
}
/**
* Get the amino acid sequence for an interval.
* Assumptions and conventions
* <p/>
* The start and end positions are on the positive strand
* irrespective of the read direction.
* <p/>
* Reading will begin from the startPosition if strand == POSITIVE, endPosition if NEGATIVE
*
* @param strand
* @param startPosition
* @param seqBytes
* @return AminoAcidSequence, or null if seqBytes == null
*/
public synchronized AminoAcidSequence getAminoAcidSequence(Strand strand, int startPosition, byte[] seqBytes) {
if (seqBytes == null) {
return null;
} else {
String nucSequence = new String(seqBytes);
List<AminoAcid> acids = getAminoAcids(strand, nucSequence);
return new AminoAcidSequence(strand, startPosition, acids, currentCodonTable.getKey());
}
}
/**
* Return a list of amino acids for the input nucleotides
*
* @param strand
* @param startPosition
* @param nucleotides
* @return
*/
public synchronized AminoAcidSequence getAminoAcidSequence(Strand strand, int startPosition, String nucleotides) {
if (nucleotides == null) {
return null;
} else {
List<AminoAcid> acids = getAminoAcids(strand, nucleotides);
return new AminoAcidSequence(strand, startPosition, acids, currentCodonTable.getKey());
}
}
/**
* Given the 'name' of an amino acid, find a match. Lookups
* can be by full name, short form, or single letter. Note that
* in the case of multiple matches, the first is returned.
* This matters most for the stop codon, whose full name
* is ambiguous (ochre, amber, opal) if the the short form
* or single letter is used.
*
* @param name
* @return
*/
public static AminoAcid getAminoAcidByName(String name) {
initAANameMap();
AminoAcid aa = AANameMap.get(name);
if (aa == null) {
aa = AminoAcid.NULL_AMINO_ACID;
}
return aa;
}
public static String getNucleotideComplement(String sequence) {
char[] complement = new char[sequence.length()];
int jj = complement.length;
for (int ii = 0; ii < sequence.length(); ii++) {
char c = sequence.charAt(ii);
jj--;
switch (c) {
case 'T':
case 't':
complement[jj] = 'A';
break;
case 'A':
case 'a':
complement[jj] = 'T';
break;
case 'C':
case 'c':
complement[jj] = 'G';
break;
case 'G':
case 'g':
complement[jj] = 'C';
break;
default:
complement[jj] = c;
}
}
return new String(complement);
}
public Set<String> getMappingSNPs(String codon, AminoAcid mutAA) {
Set<String> mapSNPs = new HashSet<String>();
Set<String> SNPs = getAllSNPs(codon);
for (String modCodon : SNPs) {
//We use short name because all 3 stop codon have different long names,
//and we don't care about the difference here.
if (currentCodonTable.getAminoAcid(modCodon).equalsByName(mutAA.getShortName())) {
mapSNPs.add(modCodon);
}
}
return mapSNPs;
}
/**
* Gets all possible strings which are a SNP from
* the provided sequence. Does not include original in
* returned set. Assumes sequence is DNA sequence, consisting
* of A,T,G,C, and uses that set to create SNPs.
*
* @param sequence
* @return
*/
public static Set<String> getAllSNPs(String sequence) {
Set<String> SNPs = new HashSet<String>();
char[] bps = "ATGC".toCharArray();
char[] orig = sequence.toCharArray();
char[] mod;
for (int loc = 0; loc < orig.length; loc++) {
mod = orig.clone();
for (char bp : bps) {
if (bp == orig[loc]) {
continue;
}
mod[loc] = bp;
SNPs.add(new String(mod));
}
}
return SNPs;
}
/**
* Load codon tables from the specified path. If any exceptions occur
* while loading, no changes are made to this instance.
* <p/>
* Note that the new codon tables are ADDED to the existing tables
* <p/>
* The currentCodonTable is set to be the codonTable with id = defaultid if present
* If not, the first one in the array is set as default
*
* @param codonTablesPath
* @return
*/
synchronized void loadCodonTables(String codonTablesPath) throws IOException, JsonParseException {
LinkedHashMap<CodonTableKey, CodonTable> newCodonTables = new LinkedHashMap<CodonTableKey, CodonTable>(20);
CodonTable defaultCodonTable = null;
InputStream is = AminoAcidManager.class.getResourceAsStream(codonTablesPath);
if (is == null) {
is = ParsingUtils.openInputStream(codonTablesPath);
}
if (codonTablesPath.endsWith(".json")) {
JsonObject allData = readJSONFromStream(is);
int defaultId = -1;
defaultId = allData.get("defaultid").getAsInt();
JsonArray codonArray = allData.get("Genetic-code-table").getAsJsonArray();
if (codonArray.size() == 0) {
throw new JsonParseException("JSON File has empty array for Genetic-code-table");
}
for (int ca = 0; ca < codonArray.size(); ca++) {
CodonTable curTable = CodonTable.createFromJSON(codonTablesPath, codonArray.get(ca).getAsJsonObject());
newCodonTables.put(curTable.getKey(), curTable);
if (defaultCodonTable == null || curTable.getId() == defaultId) {
defaultCodonTable = curTable;
}
}
} else {
throw new IllegalArgumentException("Unknown file type, must be .json");
}
allCodonTables.putAll(newCodonTables);
currentCodonTable = defaultCodonTable;
}
// private static JsonObject readJSONFromStream(InputStream is) throws JsonParseException {
// BufferedReader reader = new BufferedReader(new InputStreamReader(is));
// JSONTokener tokener = new JSONTokener(reader);
// return new JsonObject(tokener);
// }
private static JsonObject readJSONFromStream(InputStream is) {
BufferedReader reader = new BufferedReader(new InputStreamReader(is));
JsonParser parser = new JsonParser();
return parser.parse(reader).getAsJsonObject();
}
/**
* Initialize table of amino acid names, for easy lookup of
* AminoAcid by symbols. This method is idempotent, only called once
* to read name file.
*/
private synchronized static void initAANameMap() {
if (!AANameMap.isEmpty()) {
return;
}
try {
InputStream is = AminoAcidManager.class.getResourceAsStream(AANameFilePath);
if (is == null) {
return;
}
BufferedReader reader = new BufferedReader(new InputStreamReader(is));
String nextLine;
while ((nextLine = reader.readLine()) != null) {
if (nextLine.startsWith("#")) continue;
String[] tokens = nextLine.split(" ");
if (tokens.length == 3) {
String fullName = tokens[0].trim();
String shortName = tokens[1].trim();
String symbol = tokens[2].trim();
assert symbol.length() == 1;
AminoAcid aa = new AminoAcid(fullName, shortName, symbol.charAt(0));
for (String sym : new String[]{fullName, shortName, symbol}) {
if (!AANameMap.containsKey(sym)) {
AANameMap.put(sym, aa);
}
}
}
}
} catch (IOException ex) {
log.error(ex);
throw new RuntimeException(ex);
}
}
public Collection<CodonTable> getAllCodonTables() {
return Collections.unmodifiableCollection(allCodonTables.values());
}
public CodonTable getCodonTable() {
return currentCodonTable;
}
private static void loadDefaultTranslationTables() throws JsonParseException {
InputStream is = AminoAcidManager.class.getResourceAsStream(DEFAULT_TRANS_TABLE_PATH);
JsonObject allData = readJSONFromStream(is);
JsonArray organisms = allData.get("organisms").getAsJsonArray();
for (int ind = 0; ind < organisms.size(); ind++) {
JsonObject obj = organisms.get(ind).getAsJsonObject();
//Process each translation table setting
String genomeId = obj.get("genomeId").getAsString();
String codonTablePath = DEFAULT_CODON_TABLE_PATH;
try {
Object tmpPath = obj.get("codonTablePath");
if (tmpPath != null && tmpPath != JsonNull.INSTANCE && tmpPath instanceof String) {
codonTablePath = (String) tmpPath;
}
} catch (JsonParseException e) {
log.error("No codon table path found in " + DEFAULT_TRANS_TABLE_PATH + ". Using default: " + codonTablePath);
}
JsonObject chromosomes = obj.get("chromosomes").getAsJsonObject();
Iterator<Map.Entry<String, JsonElement>> iterator = chromosomes.entrySet().iterator();
while (iterator.hasNext()) {
Map.Entry<String, JsonElement> entry = iterator.next();
String chromoName = entry.getKey();
int id = entry.getValue().getAsInt();
CodonTableKey key = new CodonTableKey(codonTablePath, id);
genomeChromoTable.put(genomeId, chromoName, key);
}
}
}
// /**
// * Load the default codon table for the given genome and chromosome.
// * We check the given name, alias, and finally use the default for the specified
// * genome.
// *
// * @param genome
// * @param chrName
// */
// public void loadDefaultCodonTable(Genome genome, String chrName) {
// Map<String, CodonTableKey> chrMap = genomeChromoTable.row(genome.getId());
// String[] tryChromos = new String[]{
// chrName, genome.getCanonicalChrName(chrName), DEFAULT_CHROMO_KEY
// };
// for (String tryChromo : tryChromos) {
// if (chrMap.containsKey(tryChromo)) {
// setCodonTable(chrMap.get(tryChromo));
// return;
// }
// }
// }
public static class CodonTableKey {
private final String sourcePath;
private final int id;
private CodonTableKey(String sourcePath, int id) {
this.sourcePath = sourcePath;
this.id = id;
}
@Override
public boolean equals(Object object) {
if (object instanceof CodonTableKey) {
CodonTableKey other = (CodonTableKey) object;
return this.id == other.id &&
Objects.equal(this.sourcePath, other.sourcePath);
}
return false;
}
@Override
public int hashCode() {
return Objects.hashCode(this.sourcePath, this.id);
}
public int getId() {
return id;
}
}
/**
* Store information about current codon translation table.
* Intended to be loaded from external resource, and then never modified.
* To that end, collections contained here are set to be unmodifiable
*/
public static class CodonTable {
private final CodonTableKey key;
private final List<String> names;
private final Set<AminoAcid> starts;
private final Map<String, AminoAcid> codonMap;
/**
* Get the amino acid represented by this codon
*
* @param codon
* @return
*/
public AminoAcid getAminoAcid(String codon) {
if (codon.length() != 3) {
throw new IllegalArgumentException("Codon must be length 3: " + codon);
}
AminoAcid aa = codonMap.get(codon);
if (aa == null) {
return AminoAcid.NULL_AMINO_ACID;
}
return aa;
}
private CodonTable(String path, int id, List<String> names, Set<AminoAcid> starts, Map<String, AminoAcid> codonMap) {
this.key = new CodonTableKey(path, id);
this.names = Collections.unmodifiableList(names);
this.starts = Collections.unmodifiableSet(starts);
this.codonMap = Collections.unmodifiableMap(codonMap);
}
private static CodonTable createFromJSON(String sourcePath, JsonObject jsonObject) throws JsonParseException {
int id = jsonObject.get("id").getAsInt();
JsonArray jsonnames = jsonObject.get("name").getAsJsonArray();
List<String> names = new ArrayList<String>(jsonnames.size());
for (int nn = 0; nn < jsonnames.size(); nn++) {
names.add(jsonnames.get(nn).getAsString());
}
//Data is written as several long strings which line up
String aas = jsonObject.get("ncbieaa").getAsString();
String startString = jsonObject.get("sncbieaa").getAsString();
return build(sourcePath, id, names, aas, startString);
}
private static CodonTable build(String sourcePath, int id, List<String> names, String aas, String startString) {
String base1 = BASE_SEQUENCES[0];
String base2 = BASE_SEQUENCES[1];
String base3 = BASE_SEQUENCES[2];
checkLengths(base1, base2, base3, aas, startString);
Map<String, AminoAcid> codonMap = new HashMap<String, AminoAcid>(aas.length());
Set<AminoAcid> starts = new HashSet<AminoAcid>(aas.length());
for (int cc = 0; cc < aas.length(); cc++) {
String codon = base1.substring(cc, cc + 1) + base2.substring(cc, cc + 1) + base3.substring(cc, cc + 1);
AminoAcid aa = AANameMap.get(aas.substring(cc, cc + 1));
codonMap.put(codon, aa);
if (startString.charAt(cc) == 'M') {
starts.add(aa);
}
}
return new CodonTable(sourcePath, id, names, starts, codonMap);
}
private static void checkLengths(String... values) {
int length = values[0].length();
assert length == 64;
for (int v = 1; v < values.length; v++) {
if (values[v].length() != length) {
String msg = "Amino acid and codon strings must all be the same length.";
msg += "Expected length " + length + ", found length " + values[v].length();
throw new InputMismatchException(msg);
}
}
}
public int getId() {
return key.id;
}
public String getDisplayName() {
return names.get(0);
}
public Set<AminoAcid> getStarts() {
return starts;
}
Map<String, AminoAcid> getCodonMap() {
return codonMap;
}
@Override
public boolean equals(Object object) {
if (object instanceof CodonTable) {
CodonTable other = (CodonTable) object;
return Objects.equal(this.key, other.key) &&
Objects.equal(this.names, other.names) &&
Objects.equal(this.starts, other.starts) &&
Objects.equal(this.codonMap, other.codonMap);
}
return false;
}
@Override
public int hashCode() {
return Objects.hashCode(this.key.id, this.key.sourcePath, this.names, this.starts, this.codonMap);
}
public CodonTableKey getKey() {
return key;
}
}
}