plz help asap :) 1.What binds to the operator of the lac operon? 2.Tryptophan bi
ID: 37933 • Letter: P
Question
plz help asap :)
1.What binds to the operator of the lac operon?
2.Tryptophan binds to the:
a.operatorb.promoter
c.RNA polymerased.trp genes
e.trp repressor.
3.In the presence of tryptophan, transcription of the trp operon is on.
a.Trueb.False
4.The lac operon is expressed when:
a.glucose is high and lactose is presentb.glucose is high and lactose is absent
c.glucose is low and lactose is presentd.glucose is low and lactose is absent
e.glucose is low, regardless of the presence or absence of lactose
5.When in a complex with ________, the CAP protein binds to the CAP site and ________ the expression of the lac operon.
a.glucose ; switches onb.glucose ; switches off
c.lactose ; switches ond.cAMP ; switches on
e.cAMP ; switches off
6.In the absence of lactose, the lac repressor :
a.can bind to the operator b.cannot bind to the operator
7.In the absence of tryptophan, the trp repressor:
a.can bind to the operator b.cannot bind to the operator
8. A researcher determined that a strain of E. coli is producing a shortened version of a protein required for glucose metabolism. What type of mutation could be responsible for this shorter than normal protein?
a.nonsense mutationb.missense mutation
c.silent mutationd.sense mutation
e.none of the above
9.What type of gene mutation occurred to produce the following protein sequence?
The protein sequences written below are written using the one letter abbreviations for amino acids.Each letter represents a particular amino acid.
Normal: JAYBIRDCATPAW
Mutated: JAYBIRDBATPAW
a.nonsenseb.missense
c.silentd.sense
e.frameshift
10. Based on the gene and protein sequences that follow, what type of mutation has occurred?
Normal gene: ATGGCCGGCCCGAAAGAGACC
Mutated gene: ATGGCCGGCACCGAAAGAGACC
Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
a.nonsenseb.missense
c.silentd.sense
e.frameshift
Explanation / Answer
easy:) answering as soon as I can.
Lac repressor binds to the Lac operator region inhibits transcription.
2) tryptophan binds to the trp repressor altering it such that it can then bind to the operator region and inhibit tryptophan synthesis.
3) false. when tryptophan levels are high trp operon is turned off.
4) c when glucose is low and lactose is present.
5) d. cAMP: switches on lac operon
6) a can bind to the operator.
7) b can not bind to the trp operon
8) non sense mutation as it causes premature truncation of the transcript.
9)missense mutation.
10) frameshift insertion mutation.