Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Please explain why you chose your particular answers as well! 1. Which of the fo

ID: 49814 • Letter: P

Question

Please explain why you chose your particular answers as well!

1. Which of the following scientists were NOT actively involved in efforts to study the role and structure

of DNA as the carrier of genetic material?

A. T.H.Morgan

B. Watson and Crick

C. Frederick Griffith

D. Hershey Chase

E. None of the above

2. TATA box is _______.

A. A sequence in the DNA strand of eukaryotic promoters to initiate DNA replication

B. A sequence in the DNA strand of eukaryotic promoters to initiate translation

C. A sequence in the DNA strand of prokaryotic promoters to initiate transcription

D. A sequence in the DNA strand of eukaryotic promoters to initiate transcription

E. A sequence in the DNA strand of both eukaryotic/prokaryotic promoters to initiate

Transcription

3. Though the Untranslated regions of mRNA do NOT code for protein, they are required to function in

_______.

A. DNA replication and Mitosis

B. Signaling for Translation and survival of mRNA

C. Signaling for Transcription and mRNA degradation

D. DNA replication and Meiosis

4. You isolate a gene sequence for a research study and you later isolate the corresponding mRNA.

Upon comparing both mRNA and DNA, the mRNA contains ~ 1500 fewer bases than DNA. Which of the

following BEST explains the discrepancy?

A. Post transcription, the mRNA might have degraded

B. The mRNA strand post transcription has undergone splicing, and only the exons are present

C. It does not make sense, because mRNA and DNA are always of similar lengths.

D. It makes sense, because the base pair difference between DNA template and a transcribed mRNA

strand is always ~ 1500 bases

5. Both prokaryotes and Eukaryotes may have different classes of RNA molecules, namely mRNA, rRNA

snRNA and tRNA. Which of the following percentages are most appropriate in a eukaryotic cell?

A. 50% mRNA and 50% tRNA + rRNA

B. 80% rRNA and 20% of all other kinds

C. 10% each of mRNA, rRNA, tRNA and snRNA

D. 80% mRNA and 20% of all other kinds

E. 33% each of mRNA, tRNA and rRNA and 1% of snRNA

6. Insulin is a protein secreted by the cells into our blood stream. The Islets of Langerhans cells in

pancreas contain__?

A. Mostly free ribosomes in the cytosol to produce Insulin

B. Mostly bound ribosomes to the endomembrane system and the resulting Insulin marked by signal

peptides

C. Mostly bound ribosomes to the endomembrane system and the resulting Insulin not marked by signal

peptides

D. Mostly free ribosomes in the cytosol that attach a signal peptide to Insulin after translation

7. Which of the following is the correct order in which the following enzymes (proteins) take part in

DNA duplication?

A. Helicase, DNA ligase, Primase, DNA polymerase I, DNA Polymerase III

B. Helicase, DNA polymerase I, DNA Polymerase III, DNA ligase, Primase

C. Helicase , Primase, DNA Polymerase III, DNA polymerase I, DNA ligase

D. DNA polymerase I, DNA Polymerase III, Helicase, DNA ligase, Primase

E. Primase, Helicase , DNA Polymerase I, DNA polymerase III, DNA ligase

8. Which of the following mRNA strands has the best chances to be actively translated into a

polypeptide?

A. 5’ AAACCCAAGAUGUUUUUUCCCUGAAAAAAAA 3’

B. 5’ CCCAAGAUGUUUUUUCCCUGAAAAAAAAAAA 3’

C. 5’ 7mGCCCAAGAUGUUUUUUCCCUGA 3’

D. 5’ 7mGCCCAAGUUUUUUCCCUGAAAAAAAA AAA3’

E. 5’ 7mGCCCAAGAUGCCCAAAUUUUUUCCCUGAAAAAAAA 3’

9. Which of the following class of enzymes would likely have the most profound effect on the functions

of a cell?

A. Enzymes involved in histone modifications

B. Enzymes involved in DNA repair

C. Enzymes associated with ion channels and membrane proteins

D. Enzymes associated with plasma/cell membrane

E. None of the above

10. Based on your knowledge from transcription and translation- Which of the following is an odd RNA

amongst the following types of molecules?

A. tRNA

B. telomere RNA

C. microRNA

D. mRNA

E. rRNA

Explanation / Answer

1.

Watson and Crick discovered the DNA sructure. Frederick Griffrith has proved DNA as genetic material through transformation experiment. Hershey Chase coducted the experiment to prove the DNA as genetic material by observing the DNA of bacterial virus (Bacteria phages). TH Morgan was known for his experiments in modern genetics. He was not concerned with the experiments related to prove the DNA as genetic material. Therefore, the Option A is correct.

2.

TATA box is the promoter located in a DNA sequence to initiate the transcription in prokaryotes. Option C is correct.

3.

Though the Untranslated regions of mRNA do NOT code for protein, they are required to function in Signaling for Translation and survival of mRNA . Option B is correct.

4.

When both mRNA and DN are compared, the mRNA contains ~ 1500 fewer bases than DNA, this might be due to posttranscription changes and mRNA might lost few bases. Option A is correct.

5.

In eukayotes, 80% of RNA constitutes rRNA and 20% all other kinds of RNA. Option B is correct.

6.

The Islets of Langerhans cells in pancreas contain mostly bound ribosomes to the endomembrane system and the resulting Insulin marked by signal peptides. Option B is correct.

7.

In DNA replication, the enzymes involved are primase, helicase, DNA polymerase I, DNA polymerase III and DNA ligase. Option E is correct.

8.

To get translated mRNA must contain 7 - methyl guanosine on 5` end and after processing the mRNA posesses poly A tail. So the sequence 5’ 7mGCCCAAGAUGUUUUUUCCCUGA 3’ have high chances to get translated. Option C is correct.

9.

Enzymes associated with ion channels and membrane proteins have profound effect in functions of a cell . Option C is correct.

10.

Telomere RNA is an odd RNA regading transcription and translation. Option B is correct.