Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

The following DNA sequence contains a protein coding sequence (i.e., open readin

ID: 52021 • Letter: T

Question

The following DNA sequence contains a protein coding sequence (i.e., open reading frame). The start codon (ATG) and stop codon (TAA) are underlined/bold. You wish to use PCR to amplify the coding sequence and "end-tailor" the sequence to contain a XbaI restriction site (TCTAGA) 5' of the start codon, and a SacI site (GAGCTC) 3' of the stop codon. Design 2 oligonucleotde primers (forward and reverse) that will achieve these goals, and provide the sequences, indicating the 5' and 3' ends of the oligonucleotides.

5'-CTAGAGGATCCAGCATCCAGAGATATGGTTGTTAACTATGTTAATACTAATGTGGGTTTGAAGATCAGGCAACTCTTGTGGTTTCATATATCTTGCCTTACTTTTGGAAGAGAGACTGTACTTGAATAT

TTGGTCTCTTTTGGAGTGTGGATTAGAACTCCTCCAGCCTATAGACCACCAAATGCCCCTATCTTGTCGACTCTTCCAGAAACTACTGTTGTTCGAAGAAGGGACAGGGGCAGATCCCCTAGACGTAGAAC

TCCCAGCCCTAGAAGAAGGAGATCCCCATCTCCTAGGCGTAGATAAGAGCTCTCTCAACAATCTAGCTAGAGTTTGCTCCTATCTATATGTAATAAGGTATGCTGATATGCACTATTCAA-3'

Explanation / Answer

The oligonucleotide primers are short single stranded DNA or RNA molecule. They are intended to hybridize the ends of the DNA to be amplified by PCR. In the given condition, the sequence should be amplified in such a way it contains XbaI restriction site (TCTAGA) 5' of the start codon and SacI site (GAGCTC) 3' of the stop codon. The oligonucleotide primers should be designed in such a way they induce these restriction sequences in the DNA sequence.