Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

You have determined the sequence of a cDNA clone to be: TATAAACTGGACAACCAGTTCGAG

ID: 534438 • Letter: Y

Question

You have determined the sequence of a cDNA clone to be: TATAAACTGGACAACCAGTTCGAGCTGGTGTTCGTGGTCGGTTTTCAGAAGATCCTAACGCTGACGTACGTAGACAAGTTGATAGATGATGTGCATCGGCTGTTTCGAGACAAGTA Since the cDNA sequence is so short, you suspect it contains only a portion of the protein coding sequence. Using the table below (and the single letter codes), what is the partial protein sequence? Remember, there are 3 possible reading frames. How did you decide which reading frame to use?

(A) (B) The Genetic Code UUU Phe (F) UCU Ser (S) UAU Tyr (Y) UGU Cys (C) UUC UAC UGC UCC UUA Leu (L UCA UAA Stop UGA Stop UUG UCG UAG Stop UGG Trp (W) CUU Leu (L) CCU Pro (P) CAU His (H) CGU Arg (R) CUC CGC CAC CAA Gln (o) CGA CUA CCA CUG CCG CGG CAG AUU lle (l) ACU Thr (T) AAU Asn (N) AGU Ser (S) AUC II ACC AAC AGC AAA Lys (K) AGA Arg (R) AUA ACA AUG Met (M) ACG II AAG AGG GUU Val (V) GCU Ala (A) GAU Asp (D) GGU Gly (G) GUC GCC GGC GAC GUA GCA GAA Glu (E) GGA GCG GUG GAG tb 10-06

Explanation / Answer

The sequence will be GCU CAG UCA GAU and protein sequence will be alanine glycine serine asp..dideoxy nucleotides are inhibitor of chain elongation of DNA polymerase.