You plan to use mutagenesis to add a restriction site to facilitate cloning of y

Question

You plan to use mutagenesis to add a restriction site to facilitate cloning of your favorite gene into an expression vector. Which of the primer pairs listed could be used to place an EcoRI restriction site (GAATTC) at the 5' end of the underlined atg? 5 ' ttcacttttgctgaactatgttttaattggctatccgcaatacatttttacaggcattcc3 ' 3 ' aagtgaaaacgacttgatacaaaattaaccgataggcgttatgtaaaaatgtccgtaagg5 5 ' -gaactGAATTCatgtt-3' 5'-aacatGAATTCagttc-3' 5 ' -gctgaactGAATTC-3' 5 ' -ggaatgcctgtaa-3' C) 5 ' -GAATTCatgtttta-3' 5'-ggaatgcctgtaa-3' d) 5 ' -CTTAAGtacaaaatt-3' 5'-ccttacggatttt-3'

Explanation / Answer

a) would be the best option. The EcoR1 recognition site is present in both forward as well as reverse primer. So, ultimately both the 5' ends will have the restriction sites.

Related Questions

Navigate

• Browse (All)
• Browse Y
• Subjects

---