Using the formula given, calculate the melting temperature (T m ) for the S361C
ID: 60799 • Letter: U
Question
Using the formula given, calculate the melting temperature (Tm) for the S361C (+) primer.
Tm (oC) = 81.5 + 0.41 x (%G+C) – 675/N - % mismatch
How do I calculate the % mismatch?
Thanks
S361C(+): 5' CTCACCATGTTGATTTTGCTTACGATG ATTGTGAACAAATATTGC 3" length: 45, GC: 35.6 Tm: to be calculated Primer does not form Self 3'-dimer Primer does not form Hairpin Secondary structure (weak, moderate or strong) (+) 5'-CTCACCATGTTGATTTTGCTTACGATGATTGTGAACAAATATTGC-3' (Primer) ) 5'-CTCACCATCTTGATTTTGCTTACCATGATTCTGAACAAATATTGc-3' 1mz2A 3'-GAGTGGTACAACTAAAACGAATGCTACTAAGACTTGTTTATAACG-5' lmrA CCAAAATCAACATGGTGAG 3Explanation / Answer
Details of the given primer are:
Length - 45 bases (N)
% GC - 35.6 %
Number of mismatched bases - 1; % mismatch = (1/45)*100 = 2.22 % (% mismatch is obtained by calculating the the total number of mismatched bases in the entire primer in percent form)
Thus,
the melting temperature (Tm) of the S361C (+) primer = 81.5 + 0.41 x 35.6 - 675/45 - 2.22
= 81.5 + 14.6 - 15 - 2.22
= 78.88 %
So, the Tm for the given primer is 78.88 %.