Problem 1A (4 points) You are interested in the DNA sequence below (only one str

Question

Problem 1A

(4 points)

You are interested in the DNA sequence below (only one strand shown, in 5’ to 3’ direction). You want to clone a large part of this sequence (as large as possible) into the multiple cloning site of the pUC19 vector.

The sequence of the pUC19 vector can be found here: https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool

(Use the Map.)

You have the following restriction enzymes available:

BamHI, EcoRI, HindIII, KpnI, XbaI

Which two of these restriction enzymes would you use to clone the largest fragment possible?

Steps:

·       Check if all the enzymes given in the list above will cut within the multiple cloning site (MCS) of the vector. Use the vector map for this purpose. If any of the enzymes does not cut in the MCS, eliminate it from the analysis.

·       Go to the following site to analyze the insert: http://rna.lundberg.gu.se/cutter2/

·       Paste the insert sequence. Define all enzymes that you want to use (under “Please indicate which enzymes to include in the analysis”). Click “Analyze sequence”.

·       You will see the DNA double strand with restriction sites indicated. You will also see a table at the bottom that may be helpful.

·       Which two restriction enzymes will give you the largest fragment?

Insert for pUC19

(sequence from 5’ to 3’, only one strand shown)

ACGTTGAAAGCAAGCTTGGGGTACCTCTAATTCAAGCAACCATCATGGCAGTACCTACTCAATTACTACACAACCTATTGCTTATTACAAAAATCTACAACTCTAGACACAACATGTCTAGCGTTCCCATAAGAACGAATTTTTCACTGAAAGGTTCTTCCAAACTTGTTAGCGAATTTTTTGAATATGCGGTGAACTCAATCCTTTTTCAACGAGGAATTTACCCAGCAGAAGACTTCAAAGTTGTTCGGAAATATGGATTAAATATGCTTGTCAGTGTAGATGAAGAGGTCAAGACTTACATTCGAAAAATTGTATCTCAGTTACACAAATGGATGTTTGCAAGAATTCAAAAAATTCAAAAACTGATTTTGGTAATTACTAGTAAATGTTCAGGTGAAGATTTAGAGCGGTGGCAGTTTAATGTGGAGATGGTTGACACAGCTGATCAATTTCAGAACATTGGCAACAAAGAAGATGAACTGCGAGTACAAAAAGAAATTCAAGCTCTAATTCGTCAAATCACTGCTACAGTGACCTTTTTGCCTCAACTAGAAGAACAGTGTACGTTTAACGTTTTGGTATACGCTGATAAAGACAGCGAAGTTCCAACAGATTGGGTAGACAGTGATTCGACCCTAGGATTTTAAGAGATGCTGAACAAGTTCAATTACGAAGTTTTAGTACGAGTATGCACAAAATTGATTGTCAAGTTGCATATCGAGTGAATCCTTAGTTGTTTTTTTTGGCATGATCCTTACCTATTAGATGAGATAATCCTCTAGATAGAAAACAGCTTTGATGTGGATCCGTTCTATGAATTCAAATCTC

Problem 1B

(2 points)

You have performed this cloning and now have the circular pUC19 vector with the insert.

If you digest this new vector (pUC19 + insert) with KpnI, how many fragments will you see on a gel?

Pay attention to the fact that the vector is circular.

Problem 2A

(4 points)

You want to clone the coding piece of DNA shown in blue into the pUC19 vector.

(sequence is given from 5’ to 3’, only one strand shown)

TACCTCTAATTCAAGCAACCATCATGGCAGTACCTACTCAATTACTACACAACCTATTGCTTATTACAAAAATCTACAACTCTAGACACAACATGTCTAGCGTTCCCATAAGAACGAATTTTTCACTGAAAGGTTCTTCCAAACTTGTTAGCGAATTTTTTGAATATGCGGTGAACTCAATCCTTTTTCAACGAGGAATTTACCCAGCAGAAGACTTCAAAGTTGTTCGGAAATATGGATTAAATATGCTTGTCAGTGTAGATGAAGAGGTCAAGACTTACATTCGAAAAATTGTATCTCAGTTACACAAATGGATGTTTGCAAGAATTCAAAAAATTCAAAAACTGATTTTGGTAATTACTAGTAAATGTTCAGGTGAAGATTTAGAGCGGTGGCAGTTTAATGTGGAGATGGTTGACACAGCTGATCAATTTCAGAACATTGGCAACAAAGAAGATGAACTGCGAGTACAAAAAGAAATTCAAGCTCTAATTCGTCAAATCACTGCTACAGTGACCTTTTTGCCTCAACTAGAAGAACAGTGTACGTTTAACGTTTTGGTATACGCTGATAAAGACAGCGAAGTTCCAACAGATTGGGTAGACAGTGATTCGACCCTAGGATTTTAAgGAGATGCTGAACAAGTTCAA

You want to use the restriction enzymes BamHI and KpnI to insert the piece into pUC19. These sites are not present in the DNA piece. You will therefore use a PCR reaction to attach these restriction sites.

You will design standard PCR primers (20 nucleotides long) that amplify the entire blue region, but then add to the 5’ end of one of these primers the BamHI site, and to the 5’ end of the other primer the KpnI site. The BamHI site should be close to the ATG start codon (in bold above); the KpnI site should be close to the TAA stop codon (also in bold).

Do not add unnecessary nucleotides between the restriction enzyme site and your original primer.

If you check this site

https://www.neb.com/tools-and-resources/usage-guidelines/cleavage-close-to-the-end-of-dna-fragments

you will find that the BamHI site needs to be 3 bases away from the end of the primer to be cleaved efficiently and the KpnI site needs to be 2 bases away from the end of the primer. Therefore, add 5’TTA3’ to the 5’ end of the BamHI site, and 5’AT3’ to the 5’ end of the KpnI site.

What is the sequence of the two primers? (One of your primers should have 29 bases total, the other 28 bases total.)

Explanation / Answer

Problem 1A: You can use Hind lll and EcoR1 pair to clone the largest DNA fragment into the PUC19 vector from your sources giving reports.

Problem 1B: 2 fragments can be seen here. The plasmid itself has one Kpnl site at 3' side of MCS region (Hind lll is at 5' end of the MCS, EcoR1 is at 3' end of MCS). In your insert also there is a Kpnl site that close to Hind lll, so after its cloning into the plasmid in 5'---->3' direction, the insert having Kpnl site will be located in the 5'-side of MCS, so that, here we can see one break at this site and another break in naive plasmid containing Kpnl site, resulting the production of 2 fragments in cloned plasmid.   

2A. Forward primer: 5'-GGATCCTTA ATGGCAGTACCTACTCAATT-3'

Reverse primer: 5'-GGTACCAT TTA AAA CCT TAG GGT CGA AT-3' (reverse complementary from 3'end of the insert)

Related Questions

Navigate

• Browse (All)
• Browse P
• Subjects