1. A friend plans to use EcoRI to insert a gene into a plasmid. He then plans to
ID: 64959 • Letter: 1
Question
1. A friend plans to use EcoRI to insert a gene into a plasmid. He then plans to grow the plasmid in Escherichia coli strain R. He asks you to evaluate his plan. How do you respond?
2. Another friend plans to use EcoRI to insert a gene into a plasmid. She tells you that the sequence of the gene that she is interested in cloning is:
3' ATCCGATTCGTAGATGATCGATTCAACTCTCTCAGCTTAAGGCAT 5'
She asks you to evalutate her plan. How do you respond? (Recognition site for EcoRI is GAATTC)
3. Ampicillin is a bacteriostatic antibiotic. (Instead of killing bacteria, it inhibits their growth.)
Ramon plated bacteria transformed with a plasmid that confers ampicillin resistance. He plates the bacteria on Thursday and left them in a 37C incubator overnight. On Friday, he observed moderately sized bacterial colonies. He decided to leave them in the incubator a little longer before picking the colonies that he wanted to work with. Unfortunately, he forgot about the plate and left it in the incubator over the weekend. On Monday, his plate had large colonies that were each surrounded by very small colonies.
A. Interpret and explain Ramon's observations.
B. Predict what he will find when he picks some large and some small colonies and follows the plasmid isolation protocol for each of the colonies.
Explanation / Answer
1. The plan to use the enzyme Eco R1 to insert a gene in plasmid sounds good, provoded the same ends are available for ligation in the plasmid. Growing or using E.coli strain R can certainly demonstrate the success of transformation as growth of right colonies resistant to antibiotic will only grow in the medium, thus ensuring the success of the whole process.
2. For the sequence 3' ATCCGATTCGTAGATGATCGATTCAACTCTCTCAGCTTAAGGCAT 5'
Recognition site for EcoRI is GAATTC, which is available in above sequence hence Eco RI can be used.
3. A. There could be two options- either cloning in plasmid and subsequent transformation didnt happen propelry so that a lot of colonies grew in the medium or cloning and trandformation happened successfully but during prolonged incubation some contamination happened and ramon observed multiple colonies in the plate.
B. From some of the colonies he may pick up the positive plasmids while doing isoaltion but there might be possibility that he may recover no plasmid from some of the colonies as it may be false positives due to the growth of staphylococcus type organisms.