Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment

ID: 64961 • Letter: A

Question

A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’.

A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing via the traditional (nonfluorescent) method. Below is the DNA sequence from a region of the vector.

5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’

3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’

Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band) in the lane in which dideoxyC had been added to the sequencing reaction?  

Explanation / Answer

25, 30,31,36,37,41