Let’s say you have isolated and fully sequenced a cDNA encoding a human protein
ID: 65289 • Letter: L
Question
Let’s say you have isolated and fully sequenced a cDNA encoding a human protein implicated in basal skin cell cancer. The sequence I’ve typed here is not the usual published strand for a cDNA, but instead is the template strand for transcribing the mRNA. The sequence XXXXX indicates precisely 928 bases.
3’- tcgattagctaatacaggtcggttttcataaXXXXXggtcgcatcattcgatactggattcatt -5’
A)First, in the space above this typed strand, write the encoded mRNA sequence and indicate its directionality.
For the complementary sequence to XXXXX, just write OOOOO.
B Suppose you insert this cDNA into cultured human cells and cause them to encode high levels of the protein. You purify this protein and determine its approximate length as 319-326 amino acids. On the DNA strand I typed, circle the base triplet that serves as template for the start codon of the mRNA.
C) On the mRNA you wrote above, circle the correct stop codon of this molecule.
D) Precisely how many amino acids in length is this cancer-implicated protein? _________
E)Do you believe this protein will physically interact with Signal Recognition Particle? Explain.
F) What is the most likely intracellular location in which this protein will reside in a human basal skin cell? Explain your logic for full credit.
Explanation / Answer
TCGATTAGCTAATACAGGTCGGTTTTCATAAXXXXXGGTCGCATCATTCGATACTGGATTCATT
A). The encoded mRNA sequence is:
5’-AGCUAAUCGAUUAUGUCCAGCCAAAAGUAUUOOOOOCCAGCGUAGUAAGCUAUGA CCUAAGUAA-3’
B) TCGATTAGCTAATACAGGTCGGTTTTCATAAXXXXXGGTCGCATCATTCGATACTGGATTCATT
TAC is the start codon.
D). The length of this cancer-implicated protein is approximately 319 amino acids.
E). This protein will physically interact with Signal Recognition particle because this protein needs to be sent back into the nucleus of the cell.