Let\'s say you collaborate with another lab that is studying the ability of a sp
ID: 65407 • Letter: L
Question
Let's say you collaborate with another lab that is studying the ability of a specific protein kinase, PKC, to phosphorylate Gaz. (There has been a paper published in this area, years ago, which puts forth a hypothesis of the specific amino acid in Gaz that is phosphorylated by PKC. See this paper: http://www.jbc.org/content/270/39/23119.full.pdf+html). You give your three Gaz cDNA clones to your collaborator, and in her lab she determines that one of your three clones encodes a protein that fails to be phosphorylated by PKC, whereas your other two Gaz clones encode proteins that are phosphorylated in her experiment. Indicate which clone (A, B or C) is most likely the one that fails to be phosphorylated by PKC, explain your reasoning, and also explain how your results change the hypothesis described in the paper by Fields and Casey regarding the specific site of phosphorylation on Gaz.
Clone A: 5' - cgctgctgccagaccatgggagtcggcaagcctcagag [hundreds more bases] -3'
Clone B: 5' - cgctgctgccagaccatgggaggtcggcaaagccagag [hundreds more bases] -3'
Clone C: 5' - cgctgctgccagaccatgggatgtcggcaaqagccagag [hundreds more bases] -3'
Explanation / Answer
The sequences provided all of the three donot show any phosphorylation site as computed by software.