Translate the following RNA: 5\' CGACGAUGCCCAGAGGGGC CAAUUUUUGCUCUU AAAGCUACUGCU
ID: 67496 • Letter: T
Question
Translate the following RNA: 5' CGACGAUGCCCAGAGGGGC CAAUUUUUGCUCUU AAAGCUACUGCUUA-3' met arg arg tyr ile val ile lys lys cy met pro ser gly ala val ile lys pro met pro arg gly ala asp phe cys ser met ile val tyr gin gly his trp ser none of the above 6. What is the longest polypeptide that can be encoded by the following RNA: 5' UAGUUUGAUGGGGCCCGAUGCAUAGGUUUAUAUAUUUAU CGGGUGA-3' 5 6 8 9 10 Which are all the polypeptides that can be encoded by this DNA: 5'-CGGAGAUGCUCAGACUUUAGGCCCCAUGGGCGAAAGCAUCGGCUAAC-3' 3' GCCUCUACGAGUGUGAAAUCUGGGGCUACCCGCUUUCGUAGCCGAUUG-5' met leu arg leu only met leu arg leu & met gly glu ser ile gly met leu arg leu & met gly glu w ile gly & met leu ser pro ile gly val met gly glu ser lie gly only none of the above Rank the following mutations from least to worst effect on the polypeptide: 5'-AUGCAUAGGUAUAUACUAUUUAUCGGGUGA-3' S'-AUGCAUAGGU AAAUACUAUUUAUCGGGUGA-3- 5-AUGCAUAGAUAUAUAC UAUUUAU CGGGU GA- 3 5'-AUGCAUAGGUAUAUAC UAUU UAUCGGGUGA-3 5'-AUGfiCAUAGG U AU AU ACU AUUUAUCGGGUG A- 3' 5'-AUGCAUAGGUAUfiUACUAUUUAUCGGGUGA-3- V. IV. Ill, II ,I. II, V, I, IV, Ill. I, II, III, IV, V. IV, II, III, V, I. II, V, Ill, IV, I.Explanation / Answer
5. (c)
The given is an mRNA (sequence is given in 5' to 3' direction).
The sequence is 5' CGACG AUG CCC AGA....3'
Since AUG is the start codon, the given RNA codes for 5' Met pro arg... 3'
Thus, the correct option is (C)