EXAM 4 NAME: ATION (28 points) -You are given the following sequence: 3-ACCGCCTT
ID: 67713 • Letter: E
Question
EXAM 4 NAME: ATION (28 points) -You are given the following sequence: 3-ACCGCCTTATTGCTACCTTAGCTAAGC-5' cell? /Prokaryot (1pts.)Where does the process of replication occur in a Eukaryotic cell? /Prokaryot Cell? ucleas a. (2pts) Where does the process of replication initiate on the DNA? c. (1pts) Write the complementary sequence of the above strand STGG CGGATAACGATGGAATCGATTCG d. (3) Using the DNA sequences as templates, show the new complementary sequences after semi conservative replication and please designate their polarity. e. (12) Name at least 6 replication enzymes and state their function in replication. Helices 3,Explanation / Answer
Multiple choice :
1a,2c,3b,4c,5a,6a,7b,8c,9b,10b
Translation
a-cytoplasm
b-50S,30S
Replication
a nucleus in eukaryotic cells and in cytoplasm for prokaryotic cells
b-in the genome
e-DNA helicase-unwinds DNA double helix
DNA polymerase-builds new duplex DNA strand by adding nucleotides in 5 to 3 direction.
DNA gyrase-releives the styrain when unwound by helicase
DNA ligase-facilitates the joining of DNA strands together by stabilising the phosphodiester bond.
Topoisomerase-relaxes DNA from its super coiled nature
Primase-synthesises the short RNA ssequences called as primers which serves as starting points for DNA synthesis.
Transcription
a nucleus in eukaryotic cells and in cytoplasm for prokaryotic cells.
b35,75,90
c yes end product of transcription is mRNA
f rho dependant or rho independant terminators which terminate the transcriptions process.
g reverse transcription occurs in some viruses like HIV with the help of telomerases.