You are working on an insulin-binding protein from fish. The beginning of the co
ID: 71483 • Letter: Y
Question
You are working on an insulin-binding protein from fish. The beginning of the coding sequence of the gene is shown below. You find a mutant in the gene that cannot bind insulin (also shown below—the mutation is shaded in gray). Among a population of fish that have the gene for the mutant protein, you find one that produces a variant of this protein that can now bind insulin again (DNA sequence also shown below). What kind of mutation is this new variant?
Original sequence: atgttgtcctatgtgagttgcggcttgttg
Mutant sequence: atggtgtcctatgtgagttgcggcttgttg
Variant sequence: atggtgtcctatgtgagttgcggcttggtg
Explanation / Answer
The sequence of mutation in the variant mutant from the mutant sequence shows that original sequence of the gene is replaced. So the mutation is due to reverse mutation or intragenic suppressor mutation. But the original mutation is present in the mutant sequence and also in variant mutant so the mutation is due to intragenic suppressor mutation.
Intragenic suppressor mutation is the that occur with in the same gene due to suppression of the gene along with original mutation in the gene.