The dominant paradigm in biology describes the replication of DNA, the transcrip
ID: 73462 • Letter: T
Question
The dominant paradigm in biology describes the replication of DNA, the transcription of RNA from DNA, and the translation of proteins from mRNA. Each of these processes is highly energy intensive. Using information on the bacterial gene for the glycolytic enzyme, glucose-6-phosphate isomerase, which has1638 deoxy-nucleotides in the gene sequence and encodes for 545 amino acids in the newly translated protein enzyme. By convention the genes are always reported 5’ to 3’ with the start codon at the beginning of the gene. The amino acid sequence, by convention is always reported from the amino-terminus to the carboxy-terminus.
Gene
atgagcaatgagattgcagcgaagactcctctgacccagctttctgcctggaaggcactggctgcccacgccgaggaattgcgcggccagcatttgcgcgaactgtttgcggccgatccggagcggggaacgaagtttcggctggaggccgagggcatctacctcgattacgcgaagaaccgcatcacggcgaagacgctggaactgctgctgaagctggccgaagagagcgggctgcgcgagcgcatcgatgcgatgttccggggcgagaagatcaacatcaccgaagaccgcgcggtgctgcatgtggcgctgcgcgcgcccaagggcgcgacgatcaaggtggacggcgagaacgtggtgccggccgtgcacgaggtgctggaccgcatggcggcctttgccgagcgcgtgcgcaacggcgagtggaagggattcacgggcaagccgatcaagaacgtgatcaacgtgggcattggcggctcggacctggggccggtgatggcttatgaggcgctgaagcactatagccgccgcgacatgaacttccggtttgtgtcgaacgtggacggcacggactttgccgaggccacgcaggatctggccgcggacgagacgctgttcatcatttcgtcaaagacctttaccacgctcgaaaccatgacgaacgcgcacacggcgcggaagtgggcgctggagagcctgaaggacgagaaggcgattgcgaagcactttgtggccgtctcgacgaatgagaaggaagtgacgaagttcggcatcgacacggcaacatgttcggcttctgggactgggtgggcggccgctactcgatggactcggccattggcctttcgacgatgctggcggtgggcccggagaacttccggcgtttgctggcgggcttccatgcgatggatgagcacttcaggacggcggcgtttgacaagaatctgccggtgattctgggcctgctttcggtctggtacaacgacttttttgatgcgcagacggtggcgattctgccctatgagcaatacctgaagcgctttccggcgtatctgcaacagctcaccatggagagcaacggcaagcacgtgacgctgagcggcgcgacggtggattaccagaccgggccggtgtactggggcgagccgggcacgaacgggcagcactcgttttaccagctcattcaccagggcacaaagctgattccgtgcgacttcattgggtttgcgaagacgctgaatccgctgggcaatcatcacgatctgctgatggcgaatgtgtttgcgcagtcagaggcgctggcctttggcaagaccgccgaagaggtgaaggccgagggcgtgccggagtggctggtgccgcacaaggtcttcgagggcaaccggccgtcgaatacgctgctgctcaaggagctgacgcccgaggcgctgggcaagctgattgcgctctatgagcacattgtgttcacgcagggcgtggtgtggcaggtgaacagctttgaccagtggggcgtggagctgggcaaggtgctggcgaagaagattgccggcgagctggaaggcgatgcggagctgaagcatacagctcgaccaacacgctgatcacgcgctacaaggagctgcggggctag
Enzyme
MSNEIAAKTPLTQLSAWKALAAHAEELRGQHLRELFAADPERGTKFRLEAEGIYLDYAKNRITAKTLELLLKLAEESGLRERIDAMFRGEKINITEDRAVLHVALRAPKGATIKVDGENVVPAVHEVLDRMAAFAERVRNGEWKGFTGKPIKNVINVGIGGSDLGPVMAYEALKHYSRRDMNFRFVSNVDGTDFAEATQDLAADETLFIISSKTFTTLETMTNAHTARKWALESLKDEKAIAKHFVAVSTNEKEVTKFGIDTANMFGFWDWVGGRYSMDSAIGLSTMLAVGPENFRRLLAGFHAMDEHFRTAAFDKNLPVILGLLSVWYNDFFDAQTVAILPYEQYLKRFPAYLQQLTMESNGKHVTLSGATVDYQTGPVYWGEPGTNGQHSFYQLIHQGTKLIPCDFIGFAKTLNPLGNHHDLLMANVFAQSEALAFGKTAEEVKAEGVPEWLVPHKVFEGNRPSNTLLLKELTPEALGKLIALYEHIVFTQGVVWQVNSFQWGVELGKVLAKKIAGELEGDAELKHDSSTNTLITRYKELRG
Does this gene sequence represent the coding strand or the template strand of the DNA during transcription?
Draw the complete molecular structure of the last three ribonucleotides as a trinucleotide on the 3’ end of the mRNA transcribed from this gene.
If the DGo’ for the complete combustion of glucose to CO2 and H20 is -2,840 kJ/mole, how many grams of glucose will be consumed to replicate and transcribe one mole of this gene?
If one mole of the protein was translated from the mRNA and it takes 4 moles of ATP per peptide bond to translate this protein, how many moles of photons of 650 nm will be needed to provide the total energy required for this protein synthesis?
Explanation / Answer
Does this gene sequence represent the coding strand or the template strand of the DNA during transcription?
ATG-AGC......template strand........UAC-UCG.........Tyr-Ser-
TAC-TCG.......coding strand........AUG-AGC.........Met-Ser
This gene sequence represent the coding strand of the DNA during transcription.