I just need someone to interpret exactually what I\'m suppose to do here. I unde
ID: 7513 • Letter: I
Question
I just need someone to interpret exactually what I'm suppose to do here. I understand how to compare the sequecnces, however I don't know exactually how to put them in order. also I can't find out how to find the what chromosome the sequence came from. So far all I gather to do from this is to find which segments overlap, add the length, tell how big the chromesomeContigs and Shotgun Sequencing
In this chapter, we discussed how whole–genome shotgun sequencing methods can be used to assemble chromosome maps. Recall that in the technique of shotgun cloning, chromosomal DNA is first digested with different restriction enzymes to create a series of overlapping DNA fragments called contiguous sequences, or "contigs." The contigs are then subjected to DNA sequencing, after which bioinformatics–based programs are used to arrange the contigs in their correct order on the basis of short overlapping sequences of nucleotides.
In this Exploring Genomics exercise, you will carry out a simulation of contig alignment to help you understand the underlying logic of this approach to creating sequence maps of a chromosome. For this purpose, you will return to the National Center for Biotechnology Information BLAST site that was used in other Exploring Genomics exercises and apply a DNA alignment program called bl2seq.
Exercise I: Arranging Contigs to Create a Chromosome Map
1. Access BLAST from the NCBI Web site at http://www.ncbi.nlm.nih.gov/BLAST/. Locate and select the "Align two sequences using BLAST (bl2seq)" category at the bottom of the BLAST home page. The bl2seq feature allows you to compare two DNA sequences at a time to check for sequence similarity alignments.
2. Below are eight contig sequences taken from an actual human chromosome sequence deposited in GenBank. For this exercise we have used short fragments; however, in reality contigs are usually several thousand base pairs long. To complete this exercise, copy and paste two sequences into the Align feature of BLAST and then run an alignment (by clicking on "Align"). (Hint: Access these sequences from the Companion Web site so that you can copy and paste the sequences easily.) Repeat these steps with other combinations of two sequences to determine which sequences overlap, and then use your findings to create a sequence map that places overlapping contigs in their proper order. A few tips to consider:
•Develop a strategy to be sure that you analyze alignments for all pairs of contigs.
•Only consider alignment overlaps that show 100 percent sequence similarity.
Sequence A
CTAATTTTTTTTGTATTTTTAATAGAGACGAGGTGTCACCATGTTGGACAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCTGCCCACCTCAGCCTCCCAAAGTGCTGGGAT
TACAAGCATGAGCCACCACTCCCAGGCTTTATTTTCTATTTTTTAATTACAGCCATCCTAGTGAATGTGAAGTAGTATCTCACTGAGGTTTTGATTTGCATTTTTCTATGACA
ATGAACAATGTTTCATGTGCTTGTTGGCTGTTTGTATATCCTTTTTGGAGAAATACCAATTCATGTCCTTTGCCCATTTTTAAAGTGGATTGCATGTCTTTTTGTTGTTTAGT
TGTAAAGATGTGGGTTTTTCTTTTGAGACGGAGTCTCGCTGTCGCCTAGGCTGGAGTGCAGAGGCATGATCTCGGCTGACTGCAATCCCCACCTCCTGGCATCAAGAAGTTCT
CCTGCCTCAGCCTTCCAAGTAGCTGGGTTTACAGATGC
Sequence B
CTTTATCTCAGGACAATGAACCCGCAAGGAGAGGAAGAGCCAGTAATTCTATAGAGACTCGGAGGCGCAGGGGGCACGCTTAGTTAGAGTGGTGGTGGTATTTTCAGTGTTTT
CTGGTTTTATGATAAACACAAGCATCAATGTCTCAAGACTTTCATCTTTATCTTTTTTTTTTTTTTTTTTTTTTTCTTGAGACAGGGTTTCCCTCTGTCACCCAGGCTGGAGT
GCATTGGTGGTGTGATCTTGGCTTTCTGTAACCTCGGGCTTCTGGGCTCAAGCCGTTCTACTACCTCAGCCTCCCAAATAGCTAGAACTACAAGCGTGTGCTGCCACACCTGG
CTAATTTGTTGTATTTTATTTATTCATTTATTTTTGTGAAGACAAGGTCTTGCCATGTTGCCCAGGCTGGTCTCAGACTCCTGGGCTCAAGCAATCCACCCACCTTAGTCTCC
CAAAGTGCTGGGATTACAGGCGTGAGCCACCACACCCA
Sequence C
GGAATTTCACTCTTGTTGCCCAAGTTGGAGTGCAATGGCGCGATCTCAGCTCACTGCAACCTCCGCCTCCCAGGTTCAAACGATTCTCCTGCTTCACTCTCCCCAGTAGCTGG
GATTACAGGCTGCACCACCACACCTGGCTAATTTTTTTTGTATTTTTAATAGAGACGAGGTGTCACCATGTTGGACAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCTGCC
CACCTCAGCCTCCCAAAGTGCTGGGATTACAAGCATGAGCCACCACTCCCAGGC
Sequence D
GCTTCATCTTTCTCTTCACCGTAAAACAGGAAAGTGTGTGGTGACCAGTATTTTAAGGGAAAGGCACTTACAGAGAATTAAGCATTTGACAAAATTTATTTACAGATATTTGT
CTGTGGACCACTTCCGCACCAGCTGTGCATGAGAGGGCTCATTGCTCTGAATTTGCCTCCTTGTCTGCACCCAGGAGACCGTTTCCCAGATCACGCAAACGCTGCCTTCTCCC
CACACCAGGGCCCTCAGCATGGGAATGACCTTCCAGCGCTGCACGTTTCCAATCCATGCTCTGTTTTTCAGTTCTGGCTCACAGAGGACTGCTGGTTGCAAGCAAACTTGTAT
CTGGGTCTTCA
Sequence E
CCTTAAGTGATCTACCTGTCTCTGCCTCTCAAAGTGCTGGGATTGCAGGCATAAGCCGCCATGCCCGGCCCAAAGTTTCTTTATATGTGCTGGATACTAGGCCCGTAACAGAT
ATACAATTTGTAAATATTTTCTCTCATTTTGAAGATTTTCTTTTCACTTTCTTGATAATGTCCTTTGTGTATTTTTTGATAATGTCCTTTGATACACAAAAGTTTTTAAGTTT
GATGAAGTTCAATTTACCTATTATTTTCTTTTGTTGTTCAT
Sequence F
TGTTTGTTTGTTTGTTTTGTTTCATTTTGTTTTTGAGACAGAGTCTTGTTCTGTCGCCCAGTGTAGAGTGCAGTGGCATAATCTCGGCTCACCGTAACCTCCGCCTCCCGGGT
TCAAGCAACTCTGCCTGCCTCAGCCTCCCAAGGAGCTGGGATTATAGACGCCCACCACCATGCCTGGTTAATTTTTGTAGTTTTTTTTAGTAGAGATGGGGTTTTGCCATTTT
GGCCAGGCTGGTCTTGAACTCCTGACCTCAGGTGATCTGCCCACCCTGGCCTCTCAAAGTGCTGGGATTACAGGTGTGAGCTGCCACACTCGGCCACAACAAATTTTTGCACC
AGTTGCTCACA
Sequence G
TCCTTTGATACACAAAAGTTTTTAAGTTTGATGAAGTTCAATTTACCTATTATTTTCTTTTGTTGTTCATTCATTTTGTGTCCTATGTAGGAATCTATTGCCAAATTCAAGGT
GATAAAGATTTACCCCTATGTTTCCTTCTAAGAGTTTTATTGTTTTAGCCCTGATATTTAGCTAAACTTAATTGATTTATTAAGTTTAATTTTCCTATGTGGTATGAAGTCAT
TTATCTTCTTTAGTTCAGGATCCAAGTGAAAGGGGCATCTTCTATCTGGGACATGCCATTCTCATGACAGAGGAAAAAGACAAAAAACTGACACATACAATGACTTTAAAACT
TCACTCA
Sequence H
GGGTTTTTCTTTTGAGACGGAGTCTCGCTGTCGCCTAGGCTGGAGTGCAGAGGCATGATCTCGGCTGACTGCAATCCCCACCTCCTGGCATCAAGAAGTTCTCCTGCCTCAGC
CTTCCAAGTAGCTGGGTTTACAGATGCCCACCACCATGCCTGGCTGGTTTTTGTATTTTTAGTAGACACGGGGTTTTACCATGTTGGCCGGGCTGGTCTGGAACTCCTAACCT
TAAGTGATCTACCTGTCTCTGCCTCTCAAAGTGCTGGGATTGCAGGCATAAGCCGCCATGCCCGGCCCAAAGTTTCTTTATATGTGCTGGATACTAGGCCCGTAACAGATATA
CAATTTGTAAA
3. On the basis of your alignment results, answer the following questions, referring to the sequences by their letter codes (A through H):
a.What is the correct order of overlapping contigs?
b.What is the length, measured in number of nucleotides, of each sequence overlap between contigs?
c.What is the total size of the chromosome segment that you assembled?
d.Did you find any contigs that do not overlap with any of the others? Explain.
4. Run a nucleotide–nucleotide BLAST search (BLASTn) on any of the overlapping contigs to determine which chromosome these contigs were taken from, and report your answer.
segment is, and what chromosome it came from. here's the assignment. I just need someone to interpret how I should go about doing this.
Explanation / Answer
first compare any two sequences through BLAST. If A and B dont have sequence similarity then compare A and C. In this way, compare two sequences.
Then see if there is sequence similarity. If a part of the sequence overlaps, then both of the fragments can be put together. This forms a new fragment.
if A-------------------------
B---------------------------
Then we can overlap and mix these two fragments which gives us a new fragment.
---------------------------------------
This is the sequence after mixing sequence A and B.The dashes in bold are the overlapping sequences.
In this way, you can keep merging fragments to create a new one. I think the rest is quite simple. hope it is clear