5. You have just sequenced a short segment of DNA. You wish to analyze this DNA
ID: 772249 • Letter: 5
Question
5. You have just sequenced a short segment of DNA. You wish to analyze this DNA sequence to determine whether it could encode a protein. 5' TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATCCACT 3' a. Find the longest open reading frame (ORF). Remember, there are six possibilities. b. Label which strand on the DNA will be the sense strand, and which will be antisense when this DNA is transcribed. c. Transcribe this ORF into mRNA, indicating the 5' and 3' ends. d. Translate this mRNA into amino acids, indicating the amino (N) and carboxy (C) termini.Explanation / Answer
OPTION1: writing a GeneFinder program
A. Write a program (your choice for the programming language) that will: