9. Which of the following is true of the mechanism of transcription attenuation
ID: 80817 • Letter: 9
Question
9. Which of the following is true of the mechanism of transcription attenuation of the trp operon?
A. When an antiterminator forms in the 5’ leader sequence, transcription is terminated prematurely.
B. The stalling of the ribosome in the 5’ leader sequence leads to the formation of an antiterminator and inhibits the formation of the terminator structure.
C. The leader peptide mechanism is analogous to a repressor protein.
D. The ribosome stalls at the adjacent Trp codons when the levels of tryptophan in the cell are high.
10. Which of the following is not a characteristic of a riboswitch?
A. They are structures that can form in the 5' untranslated region of some mRNA molecules.
B. They exert gene expression control only at the level of translation.
C. They may physically bind to small-molecule metabolites.
D. Ligand-binding to a riboswitch may sequester the Shine-Dalgarno sequence.
11. The DNA sequence encoding the leader peptide of the trp operon was mutated as shown below. The wild-type and altered nucleotide is bolded for ease of identification.
ATGAAAGCAATTTCCGTACTGAAAGGTTGGTGGCGCACTTCCTGA wild type leader peptide
coding sequence
ATGAAAGCAATTTCCGTACTGAAAGGTGGGTGGCGCACTTCCTGA mutant leader peptide
coding sequence
What change in the control of trp operon expression is most likely to occur in E. coli cells containing the mutant leader peptide coding sequence compared to wild type?
A. The Trp repressor will bind more tightly to the trp operon in the mutant cells.
B. The amount of attenuation will be reduced in the mutant.
C. Negative control of the trp operon will be increased in the mutant.
D. Open promoter complexes will form less often in the mutant.
12. The packaging of eukaryotic DNA into chromatin renders most promoters inaccessible to RNA polymerases and activator proteins. Under these conditions, most eukaryotic genes are:
A. constitutively repressed.
B. constitutively activated
C. globally expressed.
D. insulated by nucleosome binding.
Explanation / Answer
Answer
9. Option D is the right answer because ribosome stall adjacent to tryptophan codon if tryptophan present in the medium since it prevents the formation of 3 to 4 stem-loop which dissociate the RNA pol and stop the transcription.
10. Option B is the right answer because riboswitches can control gene expression at the level of transcription as well as translation.
11. Option C the right answer because in mutant bacteria one tryptophan codon is mutated that is very important in attenuation process. if only one tryptophan codon is present then ribosome will move faster and allow the stem-loop formation ultimately it will increase the negative control of trp operon.
12. option D is the right answer because nucleosome tightly bound with DNA in the chromosome which makes inaccessible to RNA pol and activator factor.