Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

13. Which of the following sequences contain a six-nucleotide inverted repeat? (

ID: 81156 • Letter: 1

Question

13. Which of the following sequences contain a six-nucleotide inverted repeat?

(a) GTCACGCGACGATACGGTCACG

(b) GTCACGACTAGCCTAGTCGCTG

(c) GTCACGACTAGCCATCAGCCTG

(d) GTCACGACTAGCCCGACTAGTG

15. Which of the following is not true of the regulation of translation initiation in eukaryotes?

(a) Repressors bind to the 3' untranslated region of mRNA.

(b) Repressors bind to initiation factors.

(c) Repressors bind to translational start sites of mRNA.

(d) Repressors bind to translational release factors.

16. The 5' upstream regions of transcriptionally active genes generally do not exhibit which of the following characteristics?

(a) contain binding sites for known regulatory proteins

(b) relatively fewer nucleosomes

(c) increased in vitro sensitivity to DNase I

(d) increased concentration of histone H1

Explanation / Answer

13. b GTCACGACTAGCCTAGTCGCTG

An inverted repeat is a sequence of nucleotides followed downstream by its reverse complement. The space between the sequence and its complement may consist of zero or more nucleotides. Inverted repeats can base pair with each other in single stranded DNA or RNA.

15. d Translational release factors are involved in termination of protein synthesis.

16 d. Histone I promotes increased compaction of DNA. Transcriptionally active DNA has a more open conformation.