Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Below is a piece of DNA; the section in bold and underlined is an Intron. PROMOT

ID: 81732 • Letter: B

Question

Below is a piece of DNA; the section in bold and underlined is an Intron. PROMOTER +1 5'GGCATGTGCCTCTTAGGATGCTAGTTAAGATGGAGTAAGCCGATCCGTATGATTGCTAGCTACCTG3' 3' CCGTACACGGAGAATCCTACGATCAATTCTACCTCATTCGGCTAGGCATACTAACGATCGATGGAC5' What is the Mature mRNA produced from this DNA? What are the three RNA processing steps? (Describe them below and include these in your mRNA above) On your mRNA label the codons and tell me what protein is produced. On the DNA strand label a) The template strand and the coding strand b) The 5' and 3' UTR and Draw a box around the protein coding region

Explanation / Answer

One of the two DNA strands serve as a template for transcription. The template strand for RNA syntheis is the antisense strand of DNA which is read only from the 3' end to the 5' end by RNA polymerase because RNA polymerase can only add nucleotides to the 3' end of the growing mRNA chain. The non-template (sense) strand of DNA is called the coding strand. which code for mRNA

1. There fore mature mRNA produced from this DNA is 3' UCUUAGGAUCUAGUUAAGAAGAUG 5'

2. Post-transcriptional modification is the process where primary transcript RNA is converted into mature RNA. It is a 3 step process 1st capping, It involves the addition of 7-methylguanosine to the 5' end. Methylation of nucleotides downstream of the RNA molecule produce cap 2, cap 3 structures and so on. In these cases the methyl groups are added to the 2' OH groups of the ribose sugar. 2nd 3' processing, it begins at the 3' end of the RNA molecule involves cleavage of its 3' end and then the addition of about 250 adenine residues to form a poly(A) tail.3rd is Splicing, in which introns, regions of RNA are removed from the pre-mRNA and the remaining exons connected to re-form a single continuous molecule.

3. AUG; Meth AAG; Lys; AGA: Arg; GUU: val; CUA:Leu; GAU: Aspartic acid; UAG: stop codon

Seven out of the nine possible single-nucleotide substitutions at the AUG start codon of dihydrofolate reductase. thus it produces dihydrofolate reductase.

4 (a) above strand is template strand strand 5' -3' while below 3'- 5' is coding strand.

(b) The 5 untranslated region (5 UTR) is the region of an mRNA that is directly upstream from the initiation codon. where as 3' UTR is follows as the translation termination codon.