Biology Midterm Prep Help 1. What are the requirements for RNA polymerase (in re
ID: 83146 • Letter: B
Question
Biology Midterm Prep Help
1. What are the requirements for RNA polymerase (in replication, this would be a primase) to unction? 2. How does DNA polymerase insert the correct base? What might happen if the wrong base ends up in the DNA? 3. Take out a blank piece of paper and draw a replication fork. Label the 5' and 3' ends of the molecules and the enzymes that catalyze the process. Label the leading and lagging strands and explain the difference between them om? Where do the enzymes heel case, ligase and DNA polymerase come 5. What would replication forks look like if all enzyme activities were present except DNA ligase? 6. The optimal working temperature for Taa polymerase is 80 C. Why might this enzyme be used for R at a lower temperature of 72 C? (Hint: Think about the stability of base pairs at higher vs. PCI lower temperatures. Bio SA Topic 11 p. 8of9 7. Design a pair of PCR primers, each 10 bases long, that will amplify the following DNA fragment. Pay attention to the polarity of the primers and their sequence, and which strand they will hybridize to How large will the PCR product be? ATATTCCGACCAT CACAGCCTA.ATTGTCCATTCGAAAATT GTTGGAGATC 3' TATA AGGCTGGTAGTGTCGGATTAACAGGTAAGCTTTTAACAACCTCTAG 5' B. Look at the example shown for PCR amplification of a region containing variable repeats (page 2) (a) Why might it be important to perform a PCR reaction with no template DNA (just primers "no DNA" lane)? (b) Why was no PCR product obtained using DNA from a female female lane)? 9. What is a chromosome? What does it mean to be diploid or haploid? 10. Where does meiosis occur in a human? What happens to the haploid products of meiosis? 11. How many chromosomes are inside of a single human sperm c 12. Shown below is a diploid cell with 2n-4 undergoing either mitosis or the two divisions of meiosis. (For clarity, the nuclear membrane is not shown, and the chromosomes are shown as visible before Replication of the DNA is simila n the two processes, but what happens at the various replication. metaphase stages is very different. You should be able to explain what is happening in the figures shown below, starting with the following questions for each cell: What is the ploidy level and chromosome number of the cell, and of the daughter cells?Explanation / Answer
I shall answer the first question :
Eukaryotic RNA polymerase requires to do the following for it to carry out its function in transcription :
1. It needs to search DNA template for promoters, sites on which it will bind to initiate transcription. It then needs to create a multiprotein complex alongwith other general transcription factors for accurate initiation.
2. It requires another set of accessory factors, transcriptional activators and co-activators to regulate rate of RNA synthesis from each gene in response to various environmental and developmental signals.