Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Which of the following statements is correct regarding telomerase? A.) It extend

ID: 84537 • Letter: W

Question

Which of the following statements is correct regarding telomerase? A.) It extends the template strand of DNA. B.) It is a reverse transcriptase that contains its own DNA template. C.) It leads to a progressive loss of DNA from the ends of chromosomes. D.) It involves a primase enzyme which is a subunit of the telomerase.

Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A.) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B.) There would be a missense mutation, resulting in the substitution of an Asn for a His residue in the protein. C.) There would be a nonsense mutation, resulting in the synthesis of a truncated protein. D.) Both B and C are possible outcomes.

Explanation / Answer

Answer:

1) Which of the following statements is correct regarding telomerase?

A.) It extends the template strand of DNA.

B.) It is a reverse transcriptase that contains its own DNA template - Incorrect (it carries its own RNA template)

C.) It leads to a progressive loss of DNA from the ends of chromosomes - Incorrect (it prevents loss of DNA from the ends of chromosomes)

D.) It involves a primase enzyme which is a subunit of the telomerase - Incorrect, Primase is not a subunit of Telomerase.

2) Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC

A.) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code - Correct Answer: both ACC and ACT codes for Threonine. so even if the codon mutates to T from C, the amino acid it codes for remains unchanged.

B.) There would be a missense mutation, resulting in the substitution of an Asn for a His residue in the protein.

C.) There would be a nonsense mutation, resulting in the synthesis of a truncated protein.

D.) Both B and C are possible outcomes.