The DNA molecule whose entire sequence is given below is digested to completion
ID: 90823 • Letter: T
Question
The DNA molecule whose entire sequence is given below is digested to completion with the enzyme EcoRI (5' G^AATTC 3') How many molecules of DNA would result from this reaction? Write out the entire sequence(s) of the resultant DNA molecule(s), indicating all relevant 5'-to-3' polarities. What about this problem appears unusual (though by no means impossible) in relationship to DNA made of random nucleotide sequences? 5' AGATGAATTCGCTGAAGAACCAAGAATTCGATT 3' 3' TCTACTTAAGCGACTTCTTGGTTCTTAAGCTAA 5'Explanation / Answer
The restriction digestion will yield three molecules of DNA, as there are two restriction sites in the mentioned DNA sequence.