A sequence of DNA is shown. 5\'TAAGAATAACT CCGGTTACGGACTTAGCGCCATTGACGA3\' 3\' A
ID: 91346 • Letter: A
Question
A sequence of DNA is shown. 5'TAAGAATAACT CCGGTTACGGACTTAGCGCCATTGACGA3' 3' ATTCTTATTGAGGCCAATGCCTGAATCGCGGTAACTGCT5'How many polypeptides does this segment of DNA code for (with a start and stop codon) A 0 B 1 C 3 D 6 E all of the above Cystic fibrosis gene is 300,000 base pairs long. The transcribed portion of the gene spans 250,000 base pairs of DNA. The cytoplasmic mRNA for this gene is 6500 bases long. The protein is 1480 amino acids long. The total sizes of the introns for this gene are: A 300,000 bases B 250,000 bases C 243, 500 bases D 6500 bases E 4440 bases Which of the following elements are not transcribed? A coding region B 5' untranslated region C ribosome binding site D intron E. promoter Which of the following genetic elements are translated into a protein? A. exons B. introns C ribosome binding site D stop codon E promoter The true translators of the genetic code are A RNA polymerase B Ribosomes C tRNA D tRNA synthases E DNA polymerases Almost all primary transcripts (RNA) in the human nucleus have A Exon + intron only B 5' Untranslated region (UTR) +protein coding exons + introns +3' UTR C Intergenic region 5 UTR + protein coding exons+ introns+ 3'UTR D 5' UTR + introns + 3'UTR only E Promoters + 5' UTR + protein coding exons+ introns+ 3'UTR+ transcription terminatorExplanation / Answer
1. Answer : A : 0
5' to 3' DNA coding strand : TAA
3' to 5' DNA template strand : ATT
5' to 3' mRNA : UAA is stop codon. So it cannot initiate the protein synthesis.
2. Answer : C : 243500 bases
Total transcribed portion = 250000
Cytoplasmic mRNA (exons) = 6500
After transcription, introns are removed from total transcribed portion to result only with exons.
Introns = total transcribed portion - exons
Introns = 250000 - 6500 = 243500 bases.
3. Answer : E : Promoter
Promoter is located near the transcription start site of DNA and it initiates transcription.
All other options are part of transcribed RNA which undergo post-transcriptional modifications to result in exons or coding regions.
4. Answer : A : Exons
Exons are coding regions which is translated into a protein.
Reason for incorrect options :
Introns are non-coding regions which is not translated
Ribosome binding site is located upstream of the start codon of an mRNA transcript.
Stop codon ends the translation process.
Promoter is located near the transcription start site of DNA and it initiates transcription.