Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Genetics: Translation problem : How Do I Draw the product of Translation and How

ID: 92035 • Letter: G

Question

Genetics: Translation problem : How Do I Draw the product of Translation and How do I find the strongest promoter please help! TY

The following sequence contains two small genes in E. coli. The -35 hexamers of both promoters are boxed. raw the product of transcription in the space below the diagram for the transcript from the stronger of the two promoters. (note: inverted repeats are signified by arrows over the complementary sequence). For the purposes of this question, transcription termination in a p- dependent terminator occurs 7 bases beyond the end of the stem loop. A p-independent terminator terminates as described in class. Be sure to label the 5' and 3' ends of your RNA. Draw your RNA with the stem loop structure (draw lines to represent H-bonds between the complementary base pairs in the stem loop) 5' -AAAAAAAAGO CACGCTCTA GTGCTAGAGCGT GGCATAAGCGAAGTC ACACGTI CATTAAA CGT GT GAA 3' TTTT TTTCGCGGT GCGATAACGATCTCGCACCGTATTCGCT TCAGTGT GCAAACT GTAA TTT GCACACTT AAGCATTATATTTATTTT CAT GGAGGAC TCCTGCGA CAGCCTGT TTCCCTATTAT AAA TAGCTGTATAAGAAAA TTCGTAATATAAATALAAA GTACCTCCGG AGGACGCT GTCGGACAAAGGGATAATATTTAT CGACATATTCT TT Potential rut site AAT ATAAT TGAGGC TGTCAAf TTGTTGAGACTGAAAAAATCAGTCT CA AGCAT G-3' CGCTTGTAG TTATAT TAACT CCGCGAACA TdACAGT CA ACT GTGACTTTTTAGTCAGAGT TCGTAC-5' Potential rut site Draw the product of translation of your mRNA in the space below. The minimal Shine-Delgarno consensus sequence is 5'-AGGAGG-3'. Label N- and C-termini.

Explanation / Answer

At -35 sequence TTGACA situated in downstream

GC rich region Is the initiation of ' ,+1 nucleotide is G on strand

5'-CAUGGAGGACUCCUGCGACAGCCUCUUUCCCUAUUAUAAAUAG-3'

Translation:

Met-glu-asp-ser-cys-asp-ser-leu-phe-pro-tyr-tyr-Lys-(stop codon)

Next gene Is not completely shown in question