plz help me answer questions Medgar Evers College Problem Set Trof Small 1D The
ID: 94620 • Letter: P
Question
plz help me answer questions
Explanation / Answer
5' CCTATGCCCGCATCATTACGCACCTCTGTACATGGC 3'
3' GGATACGGGCGTAGTAATGCGTGGAGACATGTACCC 5'
1)
a) The strand of DNA which act as a template strand is 3'-5' from right to left.
b) RNA sequence 5' AUGUACAGAGGUGCG 3'
c) A single base mutation which results in the production of Met Tyr. The sequence in that mRNA is 5' AUGUACUGA 3'
2) Three Characteristics of genetic code are:
i) Genetic code is 'Universal' - same in all organisms
ii) Genetic code has 'No punctuations' - no gaps between a codon
iii) Always mRNA synthesis takes place in 5' - 3' direction only
3) DNA Polymerase III - performs polymerisation in 5' - 3' direction
RNA Polymerase - produces primary transcript RNA
Primase - enzyme involved in replication of DNA
4) If a mutant bacterium does not have an active ligase enzyme, the process of 'ligation' is disturbed. So the process of replication is disturbed.