Each of the following DNA fragments has exactly one thing wrong with it. Indicat
ID: 96919 • Letter: E
Question
Each of the following DNA fragments has exactly one thing wrong with it. Indicate a) what is wrong with the fragment, b) a possible source of the problem, c) which DNA repair mechanism(s) are necessary to completely repair the problem, and d) what the correct DNA sequence should be. For all examples, assume the top strand to be the template strand. In the last example, assume T=T is a thymine dimer, and A-A is a normal continuation of the DNA sequence.
5’-AAGACTGACTGACTGACTGACGTACTGCATGCAT-3’
3’-TTCTGACTGACTGACTGACTGCATGACGTAGGTA-5’
Explanation / Answer
a. G or guanine has been paired with another guanine.
b.This is the mismatch which may have occurred by the erroneous insertion of wrong base in place of right base.Here in place of guanine cytosine should have been inserted.
c.Mismatch repair system-Mismatches are commonly due to tautomerization of bases during DNA replication. The damage is repaired by recognition of the deformity caused by the mismatch, determining the template and non-template strand, and excising the wrongly incorporated base and replacing it with the correct nucleotide. The removal process involves more than just the mismatched nucleotide itself.
d .3' TTCTGACTGACTGACTGACTGCATGACGTACGTA 5'