What would the altered amino acid sequence be if a guanine were inserted into th
ID: 98580 • Letter: W
Question
What would the altered amino acid sequence be if a guanine were inserted into the coding strand of the genomic DNA right after base +8 of the translated region? Show your work. (Give your answer as the full name and three-letter abbreviations.)c. What is the sequence of amino acids (using the three-letter abbreviations) translated from this transcript?The E. coli genome contains the following coding strand sequence. (Note that the DNA coding strand has the same base sequence as the mRNA, except that the DNA contains Ts, instead of Us.) The transcription start site has been bold-italicized: 5'–GATGTATAATCGAGACATCCCTTAGAAATGCTTCTGCCATGGTTATTCCCACAAA–3'
a. Name the transcriptional regulatory element present upstream of the transcription start site, and describe its function.
b. Underline the translation initiation codon.
c. What is the sequence of amino acids (using the three-letter abbreviations) translated from this transcript?
d. What would the altered amino acid sequence be if a guanine were inserted into the coding strand of the genomic DNA right after base +8 of the translated region? Show your work. (Give your answer as the full name and three-letter abbreviations.)
Explanation / Answer
Answer:
a. The transcriptional regulatory element present upstream of the transcription start site is the Pribnow box: 5' TATAAT 3' (also called the -10 sequence).
Pribnow box is a part of the core promoter for bacterial transcription initiation to occur. During initiation of transcription, it is recognized and bound by a subunit of RNA polymerase.
b. The initiation codon in the DNA:
5' GATGTATAATCGAGACATCCCTTAGAA ATGCTTCTGCCATGGTTATTCCCACAAA 3'
The sequence of mRNA corresponding to this DNA segment:
5' GAUGUAUAAUCGAGACAUCCCUUAGAA AUGCUUCUGCCAUGGUUAUUCCCACAAA 3'
c. The amino acid sequence translated from this transcript is:
Single letter code: MLLPWLFPQ
3 letter code: Met Leu Leu Pro Trp Leu Phe Pro Gln
d. The DNA sequence of the translated region:
5' ATGCTTCTGGCCATGGTTATTCCCACAAA 3' (The inserted guanine has been underlined)
The altered amino acid sequence is:
3 letter code: Met Leu Leu Ala Met Val Ile Pro Thr
Full name: Methionine Leucine Leucine Alanine Methionine Valine Isoleucine Proline Threonine