A DNA fragment was sequenced using dye-terminator sequencing. In this procedure,
ID: 986720 • Letter: A
Question
A DNA fragment was sequenced using dye-terminator sequencing. In this procedure, ddATP was tagged with a green dye, ddCTP was tagged with a blue dye, ddGTP was tagged with a yellow dye, and ddTTP was tagged with a red dye. The primer used had the sequence 5'-ATGAC-3'. Given the result shown below, what was the sequence of the DNA fragment (template strand)? Note that the shortest fragments are at the bottom and the longest fragments are at the top.
Map do sapling leaning A DNA fragment was sequenced using dye-terminator sequencing. In this procedure, ddATP was tagged with a green dye, ddCTP was tagged with a blue dye, ddGTP was tagged with a yellow dye, and d was tagged with a red dye. The primer used had the sequence 5'-ATGAC-3'. Given the result shown below, what was the sequence of the DNA fragment (template strand)? Note that the shortest fragments are at the bottom and the longest fragments are at the top. 5' TACTGATACTCTTAGACATG 3'Explanation / Answer
DNA polymerase is only able to add nucleotides to the 3' end of a Primer chain. So, the sequence of the DNA fragment will be,
5'-ATGACTATGAGAATCTGTAC-3'
Rememer: Start from the bottom since shortest fragments are placed from the bottom.