Please answer question 3 genetics assignment worksheet·y2 [Compatibility Mode] a

Question

Please answer question 3

genetics assignment worksheet·y2 [Compatibility Mode] a Search in Document Home Insert Design Layout References Mailings Review View + Share A Times New Ro… 12 | A A . AaBbCeDdE No Spacing Paste Emptwsis Styles Pane Hending 1 Streng 3The ropstrand of the 3cquerce provided in quation 1 onoodos gme. The amow indicates the paumuter and its direction. The aterisk indicates the teminatoc. Write the RNA strund that is escoded by this gene. Indicue the 5" and 3 ends . Compare and ootrust eaxscription, repicamow, und ranslation Function of the Do no copy from the tet. Use your awn 4. Bolow is a strand of mRNA· s) Crclc the codoms in the Tuding frame. b) Using the codon table in your teboos detenmine theamino zcid sequence it CNA Pahymerase 5' A GAUGGUCAUGCG G A ULUA AGUA AUA 3 Heicese Rbosome actors 2. Belowis a strand of DNA. Write the sequence of the complemectary DNA strand. Indicate the S. end 3. end (NOTE: Spacing is nly fr o nization.) Page 2 of 2 232 Words Polish 93%

Explanation / Answer

m-RNA strand from the above DNA stand is

5' UACACGGGAAUGUCAUCGAU 3'

As the A is an terminator, so the mrna won't be formed further from the A with the asterisk. The gene will be coded in 5' to 3' direction.

Related Questions

Navigate

• Browse (All)
• Browse P
• Subjects

---