Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

You have discovered a new gene “X” that appears to be regulated by 3 transcripti

ID: 142433 • Letter: Y

Question

You have discovered a new gene “X” that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene “Y” appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.

The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA

The known DNA consensus sequence for each Transcription Factor is:

E2F – GCCAATGTGCTGA

SP-1 – GCTGACAGTTAA

C/EBPa – ACAGTTAATTAGG

Design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.  

Explanation / Answer

You can find the gene regulation by qPCR.